Incidental Mutations

138 incidental mutations are currently displayed, and affect 117 genes.
4 are Possibly Damaging.
9 are Probably Damaging.
105 are Probably Benign.
20 are Probably Null.
0 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 138] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511035 UTSW 1700001K19Rik 0.048 FR4304 175.59 N 12 110668449 CTT CTTTTT unclassified Homo probably benign 04/05/2018
2 511036 UTSW 1700001K19Rik 0.048 FR4304 148.79 N 12 110668450 TTC TTCGTC unclassified Homo probably benign 04/05/2018
3 510963 UTSW 4930402H24Rik 0.210 FR4304 198.47 N 2 130770748 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
4 511007 UTSW 4930433I11Rik 0.087 FR4304 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
5 511032 UTSW 4930447C04Rik 0.298 FR4304 105.46 N 12 72881287 AAGT A small deletion Homo probably benign phenotype 04/05/2018
6 510989 UTSW 4930548H24Rik 0.106 FR4304 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
7 511031 UTSW Acbd4 0.671 FR4304 214.46 N 11 103104105 CAG CAGACTAG nonsense Homo probably null phenotype 04/05/2018
8 510980 UTSW Ahdc1 0.516 FR4304 214.46 N 4 133062759 CT CTCTT small insertion Homo probably benign phenotype 04/05/2018
9 511011 UTSW Alpk3 0.657 FR4304 217.47 N 7 81077762 TCT TCTGCT small insertion Het probably benign phenotype 04/05/2018
10 510990 UTSW Anapc4 0.972 FR4304 222 N 5 52864526 T650M C T missense Homo probably damaging 1.000 phenotype 04/05/2018
11 511074 UTSW Ankhd1 0.414 FR4304 217.47 N 18 36560924 GGCGGC GGCGGCTGCGGC small insertion Het probably benign 04/05/2018
12 510974 UTSW Ankrd35 0.065 FR4304 214.46 N 3 96683847 TAGC TAGCAGC utr 3 prime Homo probably benign 04/05/2018
13 511073 UTSW Apc 0.987 FR4304 217.47 N 18 34281997 GCCAATAAA GCCAATAAAACCAATAAA intron Het probably benign phenotype 04/05/2018
14 511053 UTSW Apol6 0.028 FR4304 217.54 N 15 77051436 TTGT TTGTCTGT frame shift Het probably null phenotype 04/05/2018
15 510951 UTSW Arhgap30 0.159 FR4304 217.47 N 1 171405168 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC small insertion Het probably benign 04/05/2018
16 510992 UTSW Arpc1b 0.551 FR4304 165.47 N 5 145126791 GCC GCCTGTCC frame shift Het probably null phenotype 04/05/2018
17 511062 UTSW BC051142 0.079 FR4304 196.47 N 17 34460055 A AGCC unclassified Het probably benign 04/05/2018
18 511063 UTSW BC051142 0.079 FR4304 203.47 N 17 34460077 GC GCATC unclassified Het probably benign 04/05/2018
19 511009 UTSW Blm 1.000 FR4304 214.46 N 7 80463773 CT CTACGT frame shift Homo probably null phenotype 04/05/2018
20 511010 UTSW Blm 1.000 FR4304 181.47 N 7 80512919 TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
21 511021 UTSW Btnl10 0.140 FR4304 214.46 N 11 58923930 GA GAATA small insertion Homo probably benign 04/05/2018
22 511080 UTSW Cacna1f 0.352 FR4304 106.47 N X 7620061 AGG AGGCGG utr 3 prime Het probably benign phenotype 04/05/2018
23 511077 UTSW Calhm3 0.407 FR4304 214.46 N 19 47151896 CG CGG frame shift Homo probably null 04/05/2018
24 510960 UTSW Catsper2 0.233 FR4304 214.46 N 2 121397542 C CTTTTACTTTTTA nonsense Homo probably null phenotype 04/05/2018
25 510961 UTSW Catsper2 0.233 FR4304 217.47 N 2 121397782 CAT CATTAT utr 3 prime Het probably benign phenotype 04/05/2018
26 511014 UTSW Ccdc15 0.221 FR4304 127.47 N 9 37315157 AC ACTTTCC frame shift Het probably null 04/05/2018
27 511016 UTSW Ccdc162 0.154 FR4304 225.01 N 10 41556121 D1792G T C missense Het possibly damaging 0.490 04/05/2018
28 511015 UTSW Ccdc170 0.239 FR4304 130.47 N 10 4561021 CCA CCATCA small insertion Het probably benign phenotype 04/05/2018
29 510957 UTSW Ccdc73 0.203 FR4304 182.46 N 2 104991840 TAAG T unclassified Homo probably benign 04/05/2018
30 511033 UTSW Ccdc85c 0.354 FR4304 189.73 N 12 108274612 GCC GCCCCC small insertion Het probably benign phenotype 04/05/2018
31 511003 UTSW Cd22 0.000 FR4304 225.01 N 7 30878082 R2H C T missense Het possibly damaging 0.948 0.074 phenotype 04/05/2018
32 511057 UTSW Cd80 0.126 FR4304 214.46 N 16 38486315 AGA AGAGGA small insertion Homo probably benign phenotype 04/05/2018
33 511004 UTSW Cep89 0.678 FR4304 159.47 N 7 35409641 GACT G utr 3 prime Het probably benign 04/05/2018
34 510985 UTSW Cfap74 0.152 FR4304 222 N 4 155415760 D21G A G missense Homo possibly damaging 0.934 04/05/2018
35 510988 UTSW Cgref1 0.068 FR4304 178.46 N 5 30933780 T TCTA unclassified Homo probably benign 04/05/2018
36 510998 UTSW Chd4 0.982 FR4304 148.47 N 6 125122144 GCC GCCACTCCC unclassified Het probably benign phenotype 04/05/2018
37 511068 UTSW Cnpy3 1.000 FR4304 214.47 N 17 46736743 TCC TCCCCC utr 3 prime Het probably benign phenotype 04/05/2018
38 511069 UTSW Cnpy3 1.000 FR4304 217.47 N 17 46736746 TCC TCCACC utr 3 prime Het probably benign phenotype 04/05/2018
39 511026 UTSW Cntnap1 0.519 FR4304 217.47 N 11 101189581 AGCCCC AGCCCCCGCCCC unclassified Het probably benign phenotype 04/05/2018
40 511027 UTSW Cntnap1 0.519 FR4304 217.47 N 11 101189589 CCCCAG CCCCAGACCCAG unclassified Het probably benign phenotype 04/05/2018
41 511055 UTSW Col2a1 1.000 FR4304 222 N 15 97988981 C A synonymous Homo probably null 0.639 phenotype 04/05/2018
42 511020 UTSW Cpeb4 0.401 FR4304 101.46 N 11 31927638 T TGA critical splice acceptor site Homo probably benign phenotype 04/05/2018
43 510964 UTSW Cpne1 0.614 FR4304 169.47 N 2 156072025 AGA AGAGAGA frame shift Homo probably null phenotype 04/05/2018
44 510993 UTSW Cttnbp2 0.264 FR4304 217.47 N 6 18367458 ATTGCTG ATTGCTGTTGCTG utr 3 prime Het probably benign phenotype 04/05/2018
45 510991 UTSW Dhx37 0.500 FR4304 171.47 N 5 125427530 CTGG C unclassified Het probably benign phenotype 04/05/2018
46 511028 UTSW Dhx8 0.973 FR4304 214.46 N 11 101738188 CGAGAC CGAGACGGAGAC small insertion Homo probably benign phenotype 04/05/2018
47 511042 UTSW Dnah12 0.587 FR4304 222 N 14 26849385 G2817V G T missense Homo probably damaging 1.000 0.039 04/05/2018
48 510948 UTSW Dst 0.395 FR4304 225.01 N 1 34200964 S1798Y C A missense Het probably damaging 0.993 phenotype 04/05/2018
49 511079 UTSW Eif3a 0.973 FR4304 214.46 N 19 60775290 TA TATTTCA critical splice donor site Homo probably benign 04/05/2018
50 510955 UTSW Ermn 0.124 FR4304 217.47 N 2 58048078 TTC TTCCTC unclassified Het probably benign 04/05/2018
51 510956 UTSW Ermn 0.124 FR4304 187.47 N 2 58048086 CTT CTTGTT unclassified Het probably benign 04/05/2018
52 511050 UTSW Fbxo43 0.328 FR4304 217.47 N 15 36152094 GCCTGT GCCTGTTCCTGT small insertion Het probably benign phenotype 04/05/2018
53 511051 UTSW Fbxo43 0.328 FR4304 217.47 N 15 36152097 TGTGCC TGTGCCAGTGCC small insertion Het probably benign phenotype 04/05/2018
54 511052 UTSW Fbxo43 0.328 FR4304 217.47 N 15 36152100 GCCTGT GCCTGTCCCTGT small insertion Het probably benign phenotype 04/05/2018
55 510958 UTSW Fmn1 0.405 FR4304 217.73 N 2 113525774 TCCTCC TCCTCCCCCTCC small insertion Het probably benign phenotype 04/05/2018
56 510959 UTSW Fmn1 0.405 FR4304 214.57 N 2 113525783 TCC TCCTCCACC small insertion Homo probably benign phenotype 04/05/2018
57 510979 UTSW Foxd3 1.000 FR4304 208.53 N 4 99657396 GGACCCTACGGCCG GG small deletion Homo probably benign phenotype 04/05/2018
58 511044 UTSW Frmpd2 0.168 FR4304 222 N 14 33511021 L399F G T missense Homo probably damaging 1.000 phenotype 04/05/2018
59 511081 UTSW Gabre FR4304 214.46 N X 72270042 ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC small insertion Homo probably benign 04/05/2018
60 510976 UTSW Gbp2b 0.000 FR4304 115.01 N 3 142603652 I175V A G missense Het probably benign 0.002 phenotype 04/05/2018
61 511017 UTSW Gm4340 FR4304 188.47 N 10 104196072 CAG CAGAAG small insertion Het probably benign 04/05/2018
62 511018 UTSW Gm4340 FR4304 213.47 N 10 104196082 AGC AGCGGC small insertion Het probably benign 04/05/2018
63 511005 UTSW Gm5114 0.061 FR4304 97.01 N 7 39411105 R107G T C missense Het probably benign 0.000 04/05/2018
64 511006 UTSW Gm5114 0.061 FR4304 102.01 N 7 39411106 H106Q A C missense Het probably benign 0.001 04/05/2018
65 511066 UTSW Gm9573 0.202 FR4304 81.26 N 17 35622121 T G intron Homo probably benign 04/05/2018
66 511065 UTSW H2-Q4 0.021 FR4304 225.01 N 17 35380405 D155N G A missense Het probably damaging 1.000 0.032 phenotype 04/05/2018
67 511067 UTSW H2-T10 0.140 FR4304 217.47 N 17 36120281 TGTTTCCCACTG T frame shift Het probably null 04/05/2018
68 511038 UTSW Hist1h1t 0.000 FR4304 118.46 N 13 23695920 GAGAA GA unclassified Homo probably benign phenotype 04/05/2018
69 510953 UTSW Ifi203 0.079 FR4304 94.01 N 1 173928328 C T intron Het probably benign 04/05/2018
70 510952 UTSW Ifi208 0.073 FR4304 214.46 N 1 173677698 ATGGTG ATG small deletion Homo probably benign 04/05/2018
71 511037 UTSW Ighv5-9 0.116 FR4304 222 N 12 113661877 S82N C T missense Homo probably benign 0.017 0.100 04/05/2018
72 511043 UTSW Il17rd 0.000 FR4304 217.8 N 14 27082680 CGG CGGTGG utr 5 prime Het probably benign phenotype 04/05/2018
73 510967 UTSW Il2 FR4304 217.47 N 3 37125826 AGTGG AGTGGGGCTTGAGGTGG unclassified Het probably benign phenotype 04/05/2018
74 510949 UTSW Ipo9 1.000 FR4304 208.47 N 1 135386275 TCC TCCGCC small insertion Het probably benign phenotype 04/05/2018
75 510950 UTSW Ipo9 1.000 FR4304 210.47 N 1 135386279 CCT CCTACT nonsense Het probably null phenotype 04/05/2018
76 510972 UTSW Isg20l2 0.912 FR4304 173.49 N 3 87931712 AAG AAGCAG unclassified Homo probably benign phenotype 04/05/2018
77 511002 UTSW Kmt2b 1.000 FR4304 217.47 N 7 30586363 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
78 510987 UTSW Kmt2c 0.881 FR4304 214.46 N 5 25315766 TGCTGCTG TGCTGCTGCTGCTG small insertion Homo probably benign phenotype 04/05/2018
79 511024 UTSW Krt10 0.337 FR4304 209.47 N 11 99386199 CGCC CGCCGCC unclassified Het probably benign phenotype 04/05/2018
80 511025 UTSW Krt10 0.337 FR4304 217.47 N 11 99389274 CCTCCT CCTCCTACTCCT unclassified Het probably benign phenotype 04/05/2018
81 511082 UTSW Las1l FR4304 172.47 N X 95940820 GAG GAGCAG small insertion Het probably benign 04/05/2018
82 511083 UTSW Las1l FR4304 183.47 N X 95940821 AGG AGGCGG small insertion Het probably benign 04/05/2018
83 510966 UTSW Lkaaear1 0.013 FR4304 217.47 N 2 181697579 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA unclassified Het probably benign 04/05/2018
84 511047 UTSW Lrch1 0.207 FR4304 225.01 N 14 74819565 C241S A T missense Het possibly damaging 0.808 phenotype 04/05/2018
85 510975 UTSW Lrit3 0.233 FR4304 185.47 N 3 129788819 G GCTT small insertion Het probably benign phenotype 04/05/2018
86 511013 UTSW Maml2 0.188 FR4304 103.47 N 9 13621459 GCAGCAGCAACAGCAGCA GCAGCAGCA small deletion Homo probably benign 04/05/2018
87 511041 UTSW Mast4 0.518 FR4304 102.47 N 13 102734862 T TTTC utr 3 prime Het probably benign phenotype 04/05/2018
88 510971 UTSW Med12l 0.503 FR4304 183.47 N 3 59275982 AGC AGCGGC small insertion Het probably benign phenotype 04/05/2018
89 510986 UTSW Noc2l 1.000 FR4304 144.47 N 4 156240096 TGC TGCAGC small insertion Het probably benign phenotype 04/05/2018
90 511045 UTSW Nrg3 0.484 FR4304 214.47 N 14 38397273 G GACATTT small insertion Homo probably benign phenotype 04/05/2018
91 511012 UTSW Olfr635 0.139 FR4304 217.47 N 7 103979903 TCC TCCC frame shift Het probably null phenotype 04/05/2018
92 510983 UTSW Padi3 0.034 FR4304 214.46 N 4 140792972 TCTCAC TC critical splice donor site Homo probably benign phenotype 04/05/2018
93 511060 UTSW Park2 0.225 FR4304 225.01 N 17 11854763 V323M G A missense Het probably damaging 0.999 phenotype 04/05/2018
94 510962 UTSW Patl2 0.249 FR4304 200.47 N 2 122126135 GCT GCTTCT small insertion Het probably benign 04/05/2018
95 510982 UTSW Pdik1l 0.474 FR4304 214.46 N 4 134279374 TTTT TTTTGTTTTTGGTTT frame shift Homo probably null 04/05/2018
96 510999 UTSW Pik3c2g 0.134 FR4304 214.46 N 6 139635656 AG AGAGGG frame shift Homo probably null phenotype 04/05/2018
97 511078 UTSW Plekhs1 0.039 FR4304 217.55 N 19 56479858 T TTCAGACCTCCCC unclassified Het probably benign 04/05/2018
98 511071 UTSW Prkd3 0.181 FR4304 94.26 N 17 78975820 G T intron Homo probably null phenotype 04/05/2018
99 511056 UTSW Prr13 0.255 FR4304 193.92 N 15 102462177 TCC TCCCCC small insertion Homo probably benign 04/05/2018
100 510954 UTSW Prrc2b 0.222 FR4304 222 N 2 32221167 A1852T G A missense Homo probably damaging 1.000 04/05/2018
[records 1 to 100 of 138] next >> last >|