Incidental Mutations

116 incidental mutations are currently displayed, and affect 97 genes.
4 are Possibly Damaging.
11 are Probably Damaging.
83 are Probably Benign.
15 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 116] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511129 UTSW 4930433I11Rik 0.063 FR4340 217.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
2 511114 UTSW 4930548H24Rik 0.060 FR4340 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
3 511105 UTSW 4930578G10Rik FR4340 135.01 N 4 42761098 G T unclassified Het probably benign 04/05/2018
4 511096 UTSW 4932438A13Rik 1.000 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
5 511176 UTSW 7530416G11Rik 0.069 FR4340 222 N 15 85494307 E45V T A missense Homo unknown 04/05/2018
6 511087 UTSW A530032D15Rik 0.186 FR4340 81.01 N 1 85109351 N6K A C missense Het probably damaging 0.988 04/05/2018
7 511191 UTSW A530064D06Rik 0.000 FR4340 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
8 511117 UTSW Arpc1b 0.000 FR4340 178.47 N 5 145126792 CC CCTGGTC frame shift Het probably null phenotype 04/05/2018
9 511157 UTSW Arrb2 0.000 FR4340 222 N 11 70438671 T269M C T missense Homo probably damaging 1.000 phenotype 04/05/2018
10 511185 UTSW BC051142 0.080 FR4340 182.47 N 17 34460060 CAG CAGTAG nonsense Het probably null 04/05/2018
11 511186 UTSW BC051142 0.080 FR4340 185.47 N 17 34460068 GCA GCATCA unclassified Het probably benign 04/05/2018
12 511187 UTSW BC051142 0.080 FR4340 184.47 N 17 34460077 GC GCAAC unclassified Het probably benign 04/05/2018
13 511158 UTSW Bcas3 0.636 FR4340 222 N 11 85509497 V431I G A missense Homo probably benign 0.115 04/05/2018
14 511131 UTSW Blm 1.000 FR4340 217.47 N 7 80463767 ACCT ACCTGCCT unclassified Het probably benign phenotype 04/05/2018
15 511132 UTSW Blm 1.000 FR4340 178.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
16 511133 UTSW Blm 1.000 FR4340 195.47 N 7 80512910 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
17 511141 UTSW Cacna1a 0.931 FR4340 153.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
18 511198 UTSW Cacna1f 0.000 FR4340 111.47 N X 7620067 AGG AGGCGG utr 3 prime Het probably benign phenotype 04/05/2018
19 511195 UTSW Calhm1 0.000 FR4340 217.47 N 19 47141251 CTCTGTGGCTGTGGCTGTGGCTGTG CTCTGTGGCTGTGTCTGTGGCTGTGGCTGTGGCTGTG unclassified Het probably benign phenotype 04/05/2018
20 511111 UTSW Casz1 1.000 FR4340 138.72 N 4 148952302 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC small deletion Homo probably benign phenotype 04/05/2018
21 511147 UTSW Cd164 0.193 FR4340 225.01 N 10 41521926 A59S G T missense Het probably benign 0.003 0.153 phenotype 04/05/2018
22 511128 UTSW Cd22 0.000 FR4340 222 N 7 30878082 R2H C T missense Homo possibly damaging 0.948 0.074 phenotype 04/05/2018
23 511179 UTSW Cd80 0.112 FR4340 214.46 N 16 38486316 GAA GAAAAA small insertion Homo probably benign phenotype 04/05/2018
24 511177 UTSW Col2a1 1.000 FR4340 225.01 N 15 97988981 C A synonymous Het probably null 0.639 phenotype 04/05/2018
25 511145 UTSW Col6a5 0.877 FR4340 222 N 9 105934174 N715K A T missense Homo unknown phenotype 04/05/2018
26 511086 UTSW Crygc 0.000 FR4340 140.01 N 1 65071663 F155Y A T missense Het probably benign 0.001 phenotype 04/05/2018
27 511190 UTSW Cul9 0.316 FR4340 176.47 N 17 46500853 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
28 511175 UTSW Cyp2d11 0.085 FR4340 214.46 N 15 82390022 T TGGGA frame shift Homo probably null 04/05/2018
29 511142 UTSW D230025D16Rik 0.286 FR4340 222 N 8 105241098 G207E G A missense Homo probably benign 0.000 04/05/2018
30 511144 UTSW Dbr1 1.000 FR4340 217.47 N 9 99583701 AGG AGGAGGCGG unclassified Het probably benign phenotype 04/05/2018
31 511171 UTSW Dnah12 0.232 FR4340 222 N 14 26849385 G2817V G T missense Homo probably damaging 1.000 0.039 04/05/2018
32 511184 UTSW Dnah8 0.349 FR4340 217.48 N 17 30635463 ACACTGCC AC small deletion Het probably benign phenotype 04/05/2018
33 511115 UTSW Dthd1 0.140 FR4340 214.46 N 5 62843026 C CTTA small insertion Homo probably benign phenotype 04/05/2018
34 511106 UTSW Fam166b 0.085 FR4340 214.46 N 4 43427384 CAGAG CAG frame shift Homo probably null 04/05/2018
35 511197 UTSW Fam45a 0.069 FR4340 214.46 N 19 60814621 CT CTTTT small insertion Homo probably benign 04/05/2018
36 511140 UTSW Frem3 0.108 FR4340 214.46 N 8 80615241 CT CTTTT small insertion Homo probably benign phenotype 04/05/2018
37 511172 UTSW Frmpd2 0.000 FR4340 222 N 14 33511021 L399F G T missense Homo probably damaging 1.000 phenotype 04/05/2018
38 511088 UTSW G530012D18Rik 0.143 FR4340 110.47 N 1 85577152 CACACAGAGAGAGAGAGAGAGAGAGA CA small deletion Het probably benign 04/05/2018
39 511104 UTSW Gbp2b 0.000 FR4340 105.01 N 3 142603652 I175V A G missense Het probably benign 0.002 phenotype 04/05/2018
40 511094 UTSW Gm14393 0.106 FR4340 93.01 N 2 175061634 E160G T C missense Het possibly damaging 0.484 04/05/2018
41 511192 UTSW Gm16519 0.523 FR4340 204.46 N 17 70929338 A AGAAC frame shift Homo probably null 04/05/2018
42 511148 UTSW Gm4340 FR4340 170.47 N 10 104196075 CAG CAGTAG nonsense Het probably null 04/05/2018
43 511149 UTSW Gm4340 FR4340 169.47 N 10 104196098 GCAG GCAACAG small insertion Het probably benign 04/05/2018
44 511150 UTSW Gm4340 FR4340 200.47 N 10 104196099 CAGAAG CAGAAGAAG small insertion Het probably benign 04/05/2018
45 511193 UTSW Gpatch11 0.129 FR4340 217.47 N 17 78842174 AGGAAG AGGAAGGGGAAG small insertion Het probably benign 04/05/2018
46 511189 UTSW H2-Q4 0.062 FR4340 225.01 N 17 35380405 D155N G A missense Het probably damaging 1.000 0.032 phenotype 04/05/2018
47 511091 UTSW Ifi208 0.000 FR4340 214.46 N 1 173677698 ATGGTG ATG small deletion Homo probably benign 04/05/2018
48 511167 UTSW Ighv5-9 0.109 FR4340 222 N 12 113661877 S82N C T missense Homo probably benign 0.017 0.100 04/05/2018
49 511089 UTSW Ipo9 1.000 FR4340 199.47 N 1 135386269 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
50 511090 UTSW Ipo9 1.000 FR4340 185.47 N 1 135386271 CTC CTCTTC small insertion Het probably benign phenotype 04/05/2018
51 511099 UTSW Isg20l2 0.945 FR4340 205.47 N 3 87931712 AAG AAGTAG nonsense Het probably null phenotype 04/05/2018
52 511125 UTSW Kmt2b 1.000 FR4340 217.47 N 7 30586363 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
53 511126 UTSW Kmt2b 1.000 FR4340 217.47 N 7 30586369 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
54 511127 UTSW Kmt2b 1.000 FR4340 217.47 N 7 30586375 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
55 511162 UTSW Krt10 0.364 FR4340 169.47 N 11 99386202 CAC CACGAC unclassified Het probably benign phenotype 04/05/2018
56 511163 UTSW Krt10 0.364 FR4340 171.23 N 11 99386203 ACCG ACCGCCG unclassified Homo probably benign phenotype 04/05/2018
57 511164 UTSW Krt10 0.364 FR4340 217.47 N 11 99389274 CCTCCT CCTCCTTCTCCT unclassified Het probably benign phenotype 04/05/2018
58 511200 UTSW Las1l FR4340 217.47 N X 95940622 TCCTC TCCTCTACCTC small insertion Het probably benign 04/05/2018
59 511100 UTSW Lce1a1 FR4340 86.01 N 3 92646844 G108S C T missense Het unknown 04/05/2018
60 511095 UTSW Lkaaear1 0.049 FR4340 102.47 N 2 181697594 CCAGCTCCAG CCAGCTCCAGCTGCAGCTCCAG unclassified Het probably benign 04/05/2018
61 511103 UTSW Lrit3 0.000 FR4340 203.47 N 3 129788808 CTG CTGTTG small insertion Het probably benign phenotype 04/05/2018
62 511199 UTSW Mamld1 FR4340 108.47 N X 71118846 CAG CAGAAG small insertion Het probably benign phenotype 04/05/2018
63 511156 UTSW Mapk7 1.000 FR4340 193.47 N 11 61490206 TGCTGGCGCTGGTGCTGGCGCTGG TGCTGGCGCTGGCGCTGGTGCTGGCGCTGG intron Het probably benign phenotype 04/05/2018
64 511169 UTSW Mast4 0.491 FR4340 164.47 N 13 102734857 TTTT TTTTATTT frame shift Het probably null phenotype 04/05/2018
65 511170 UTSW Mast4 0.491 FR4340 215.92 N 13 102736317 GCA GCAGTGTCA small insertion Homo probably benign phenotype 04/05/2018
66 511098 UTSW Med12l 0.414 FR4340 179.47 N 3 59275985 AGC AGCCGC small insertion Het probably benign phenotype 04/05/2018
67 511178 UTSW Mfsd5 0.691 FR4340 94.01 N 15 102281161 V323I G A missense Het probably benign 0.111 04/05/2018
68 511155 UTSW Nacad 0.000 FR4340 217.47 N 11 6599761 GTC GTCAGGATC small insertion Het probably benign 04/05/2018
69 511168 UTSW Naip1 0.000 FR4340 82.01 N 13 100423076 M1140R A C missense Het probably benign 0.000 phenotype 04/05/2018
70 511097 UTSW Nbea 1.000 FR4340 128.46 N 3 56009212 TTTA T critical splice donor site Homo probably benign phenotype 04/05/2018
71 511152 UTSW Nefh 0.000 FR4340 217.47 N 11 4941033 ACTTGGCCTCACCTGGGG ACTTGGCCTCACCTGGGGCCTTGGCCTCACCTGGGG small insertion Het probably benign phenotype 04/05/2018
72 511153 UTSW Nefh 0.000 FR4340 214.46 N 11 4941038 GCCTCACCTGGGGACTTGGCCTC GCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC small insertion Homo probably benign phenotype 04/05/2018
73 511154 UTSW Nefh 0.000 FR4340 214.46 N 11 4941040 CTCACCTGGGGACTTGGCCTC CTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC small insertion Homo probably benign phenotype 04/05/2018
74 511188 UTSW Neu1 1.000 FR4340 217.49 N 17 34932558 TCTTCTA T unclassified Het probably benign phenotype 04/05/2018
75 511143 UTSW Nutf2 1.000 FR4340 97.01 N 8 105876570 D78Y G T missense Het probably damaging 1.000 04/05/2018
76 511135 UTSW Olfr495 0.172 FR4340 141.01 N 7 108395893 T258A A G missense Het probably benign 0.000 phenotype 04/05/2018
77 511136 UTSW Olfr495 0.172 FR4340 127.01 N 7 108395898 M259I G A missense Het probably benign 0.000 phenotype 04/05/2018
78 511137 UTSW Olfr513 0.127 FR4340 214.46 N 7 108754954 AT ATGATATT small insertion Homo probably benign phenotype 04/05/2018
79 511134 UTSW Olfr635 0.145 FR4340 217.47 N 7 103979903 TCC TCCC frame shift Het probably null phenotype 04/05/2018
80 511181 UTSW Park2 0.148 FR4340 222 N 17 11854763 V323M G A missense Homo probably damaging 0.999 phenotype 04/05/2018
81 511108 UTSW Pdik1l 0.000 FR4340 217.54 N 4 134279512 ACCAC ACCACCCCCAC intron Het probably benign 04/05/2018
82 511122 UTSW Pik3c2g 0.104 FR4340 214.46 N 6 139635656 AG AGAGGG frame shift Homo probably null phenotype 04/05/2018
83 511196 UTSW Plekhs1 0.049 FR4340 214.46 N 19 56479858 TCCAGAC TCCAGACCTCCCCCCAGAC unclassified Homo probably benign 04/05/2018
84 511139 UTSW Prag1 0.000 FR4340 214.46 N 8 36103886 C CAGT small insertion Homo probably benign phenotype 04/05/2018
85 511109 UTSW Pramef25 0.053 FR4340 105.01 N 4 143949742 T264M G A missense Het probably damaging 0.992 04/05/2018
86 511146 UTSW Raet1d 0.063 FR4340 125.01 N 10 22371559 Q178R A G missense Het probably benign 0.000 04/05/2018
87 511180 UTSW Serac1 0.000 FR4340 222 N 17 6070808 K70N T A missense Homo probably damaging 1.000 phenotype 04/05/2018
88 511166 UTSW Serpina3i 0.053 FR4340 138.47 N 12 104265164 CGG CGGTGG small insertion Het probably benign 04/05/2018
89 511116 UTSW Sfswap 0.000 FR4340 217.48 N 5 129569751 ACTCAGCCC ACTCAGCCCCCTCAGCCC unclassified Het probably benign phenotype 04/05/2018
90 511194 UTSW Six3 1.000 FR4340 165.47 N 17 85621356 CGG CGGGGG small insertion Het probably benign phenotype 04/05/2018
91 511113 UTSW Speer4a 0.053 FR4340 225.01 N 5 26036748 E127* C A nonsense Het probably null 04/05/2018
92 511201 UTSW Sry 0.318 FR4340 206.47 N Y 2662824 GCTGCTGCTGCTG GCTGCTGCTGCTGCTG small insertion Het probably benign phenotype 04/05/2018
93 511138 UTSW St5 0.758 FR4340 217.47 N 7 109556921 CACCACACTGGGGCAGCCCACACTGGGGCAG CCCCACACTGGGGCAG unclassified Het probably benign phenotype 04/05/2018
94 511092 UTSW Tbr1 1.000 FR4340 84.01 N 2 61806347 A C intron Het probably benign phenotype 04/05/2018
95 511101 UTSW Tdpoz2 0.427 FR4340 128.46 N 3 93651615 T TCC frame shift Homo probably null 04/05/2018
96 511102 UTSW Tdpoz4 0.826 FR4340 205.47 N 3 93796880 GAA GA frame shift Het probably null 04/05/2018
97 511118 UTSW Tgoln1 0.113 FR4340 176.23 N 6 72616351 AAG AAGCCTCAG small insertion Homo probably benign 04/05/2018
98 511112 UTSW Tmbim7 0.086 FR4340 225.01 N 5 3670064 R100C C T missense Het possibly damaging 0.503 04/05/2018
99 511159 UTSW Tob1 0.000 FR4340 170.47 N 11 94214454 AGC AGCCGC small insertion Het probably benign phenotype 04/05/2018
100 511160 UTSW Tob1 0.000 FR4340 172.47 N 11 94214460 AGC AGCCGC small insertion Het probably benign phenotype 04/05/2018
[records 1 to 100 of 116] next >> last >|