Incidental Mutations

109 incidental mutations are currently displayed, and affect 94 genes.
3 are Possibly Damaging.
10 are Probably Damaging.
83 are Probably Benign.
11 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 109] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511256 UTSW 2810004N23Rik 0.675 FR4342 214.46 N 8 124839833 TT TTATGT frame shift Homo probably null 04/05/2018
2 511206 UTSW 4930402H24Rik 0.153 FR4342 156.47 N 2 130770742 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
3 511245 UTSW 4930433I11Rik 0.087 FR4342 186.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
4 511231 UTSW 4930548H24Rik 0.106 FR4342 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
5 511293 UTSW 7530416G11Rik 0.296 FR4342 222 N 15 85494307 E45V T A missense Homo unknown 04/05/2018
6 511250 UTSW AF366264 0.476 FR4342 87.01 N 8 13837613 H159Q G C missense Het probably benign 0.002 04/05/2018
7 511216 UTSW Ankrd35 0.077 FR4342 113.47 N 3 96683515 TCCCC TCCC frame shift Het probably null 04/05/2018
8 511258 UTSW Anxa2 0.000 FR4342 130.47 N 9 69480205 CCC CCCACC small insertion Het probably benign phenotype 04/05/2018
9 511259 UTSW Anxa2 0.000 FR4342 154.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
10 511302 UTSW Apc 0.987 FR4342 214.47 N 18 34281999 CAATAAAGC CAATAAAGCAAATAAAGC intron Homo probably benign phenotype 04/05/2018
11 511272 UTSW Arrb2 0.000 FR4342 222 N 11 70438671 T269M C T missense Homo probably damaging 1.000 phenotype 04/05/2018
12 511275 UTSW Bcas3 0.537 FR4342 222 N 11 85509497 V431I G A missense Homo probably benign 0.115 04/05/2018
13 511283 UTSW Begain 0.168 FR4342 123.97 N 12 109033418 CCCCGCC CCCCGCCCCCGCC unclassified Homo probably benign 04/05/2018
14 511205 UTSW Catsper2 0.233 FR4342 210.47 N 2 121397793 TCA TCAACA utr 3 prime Het probably benign phenotype 04/05/2018
15 511263 UTSW Cd164 0.146 FR4342 222 N 10 41521926 A59S G T missense Homo probably benign 0.003 0.153 phenotype 04/05/2018
16 511244 UTSW Cd22 0.000 FR4342 222 N 7 30878082 R2H C T missense Homo possibly damaging 0.948 0.074 phenotype 04/05/2018
17 511273 UTSW Cluh 0.599 FR4342 217.47 N 11 74669524 GAGCCT GAGCCTCAGCCT small insertion Het probably benign phenotype 04/05/2018
18 511274 UTSW Cluh 0.599 FR4342 217.47 N 11 74669526 GCCTGA GCCTGAACCTGA small insertion Het probably benign phenotype 04/05/2018
19 511279 UTSW Cntnap1 0.519 FR4342 217.47 N 11 101189575 AGCCCC AGCCCCCGCCCC unclassified Het probably benign phenotype 04/05/2018
20 511294 UTSW Col2a1 1.000 FR4342 225.01 N 15 97988981 C A synonymous Het probably null 0.639 phenotype 04/05/2018
21 511261 UTSW Col6a5 0.907 FR4342 222 N 9 105934174 N715K A T missense Homo unknown phenotype 04/05/2018
22 511268 UTSW Cpeb4 0.401 FR4342 108.46 N 11 31927638 T TGA critical splice acceptor site Homo probably benign phenotype 04/05/2018
23 511255 UTSW D230025D16Rik 0.233 FR4342 222 N 8 105241098 G207E G A missense Homo probably benign 0.000 04/05/2018
24 511260 UTSW Dbr1 0.909 FR4342 217.47 N 9 99583680 AGGAGG AGGAGGGGGAGG unclassified Het probably benign phenotype 04/05/2018
25 511251 UTSW Defa29 FR4342 140.01 N 8 21326144 R69P C G missense Het probably benign 0.000 04/05/2018
26 511280 UTSW Dhx8 0.973 FR4342 148.47 N 11 101738206 CG CGAGAACGG frame shift Het probably null phenotype 04/05/2018
27 511289 UTSW Dnah12 0.587 FR4342 222 N 14 26849385 G2817V G T missense Homo probably damaging 1.000 0.039 04/05/2018
28 511232 UTSW Dthd1 0.254 FR4342 214.46 N 5 62843026 C CTTA small insertion Homo probably benign phenotype 04/05/2018
29 511297 UTSW E4f1 1.000 FR4342 102.47 N 17 24455197 GC GCCCC unclassified Het probably benign phenotype 04/05/2018
30 511303 UTSW F830016B08Rik 0.086 FR4342 214.46 N 18 60299941 A ACAG small insertion Homo probably benign 04/05/2018
31 511221 UTSW Fam166b 0.133 FR4342 214.46 N 4 43427384 CAGAG CAG frame shift Homo probably null 04/05/2018
32 511233 UTSW Fbrsl1 0.230 FR4342 157.47 N 5 110378125 GTGTGTGTGCTGGTGCGTGTGCTGGTG GTGTGTGTGCTGGTGTGTGTGCTGGTGCGTGTGCTGGTG small insertion Het probably benign 04/05/2018
33 511257 UTSW Fbxo22 0.470 FR4342 98.01 N 9 55221070 A C unclassified 231 bp Het probably null phenotype 04/05/2018
34 511213 UTSW Flg 0.143 FR4342 81.01 N 3 93290513 G A unclassified Het probably benign phenotype 04/05/2018
35 511204 UTSW Fmn1 0.405 FR4342 214.47 N 2 113525783 TCC TCCTCCACC small insertion Homo probably benign phenotype 04/05/2018
36 511290 UTSW Frmpd2 0.168 FR4342 222 N 14 33511021 L399F G T missense Homo probably damaging 1.000 phenotype 04/05/2018
37 511219 UTSW Gbp2b 0.000 FR4342 139.01 N 3 142603652 I175V A G missense Het probably benign 0.002 phenotype 04/05/2018
38 511270 UTSW Gjc2 0.000 FR4342 214.46 N 11 59182743 T TCCCG unclassified Homo probably benign phenotype 04/05/2018
39 511224 UTSW Gm13103 0.055 FR4342 165.47 N 4 143851643 AA AATA frame shift Homo probably null 04/05/2018
40 511209 UTSW Gm14496 0.079 FR4342 82.01 N 2 181995906 K258Q A C missense Het probably benign 0.006 04/05/2018
41 511264 UTSW Gm4340 FR4342 152.47 N 10 104196066 CAGAAG CAGAAGAAG small insertion Het probably benign 04/05/2018
42 511265 UTSW Gm4340 FR4342 143.47 N 10 104196099 CAGAAG CAGAAGAAG small insertion Het probably benign 04/05/2018
43 511222 UTSW Gm7534 0.090 FR4342 214.46 N 4 134202631 G GCTC small insertion Homo probably benign 04/05/2018
44 511301 UTSW Gpatch11 0.203 FR4342 217.47 N 17 78842178 AGAGGA AGAGGATGAGGA small insertion Het probably benign 04/05/2018
45 511300 UTSW H2-Q4 0.021 FR4342 222 N 17 35380405 D155N G A missense Homo probably damaging 1.000 0.032 phenotype 04/05/2018
46 511285 UTSW Hist1h1t 0.000 FR4342 122.46 N 13 23695913 TGTGG TG unclassified Homo probably benign phenotype 04/05/2018
47 511236 UTSW Hoxa3 1.000 FR4342 216.23 N 6 52170130 G GCTT unclassified Homo probably benign phenotype 04/05/2018
48 511203 UTSW Ifi208 0.073 FR4342 214.46 N 1 173677698 ATGGTG ATG small deletion Homo probably benign 04/05/2018
49 511284 UTSW Ighv5-9 0.116 FR4342 222 N 12 113661877 S82N C T missense Homo probably benign 0.017 0.100 04/05/2018
50 511239 UTSW Klra10 0.055 FR4342 120.01 N 6 130272747 R192C G A missense Het probably benign 0.008 04/05/2018
51 511243 UTSW Kmt2b 1.000 FR4342 217.47 N 7 30586375 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
52 511277 UTSW Krt10 0.337 FR4342 218.11 N 11 99386199 CGCC CGCCGCC unclassified Het probably benign phenotype 04/05/2018
53 511278 UTSW Krt10 0.337 FR4342 214.46 N 11 99386203 ACC ACCCCC unclassified Homo probably benign phenotype 04/05/2018
54 511212 UTSW Lce1m FR4342 108.47 N 3 93018247 CGCTGCTGCTGCCACAGCA C unclassified Het probably benign 04/05/2018
55 511252 UTSW Mak16 0.970 FR4342 149 N 8 31161749 E203D T G,A missense Homo probably benign 0.003 04/05/2018
56 511210 UTSW Med12l 0.503 FR4342 175.47 N 3 59275988 AGC AGCGGC small insertion Het probably benign phenotype 04/05/2018
57 511211 UTSW Med12l 0.503 FR4342 168.47 N 3 59275994 AGCGGC AGCGGCGGC small insertion Het probably benign phenotype 04/05/2018
58 511234 UTSW Mn1 0.000 FR4342 193.47 N 5 111419706 AGC AGCGGC small insertion Het probably benign phenotype 04/05/2018
59 511267 UTSW Nacad 0.381 FR4342 217.47 N 11 6599762 TC TCAGGGGC small insertion Het probably benign 04/05/2018
60 511288 UTSW Naip1 0.000 FR4342 83.01 N 13 100425471 R1062K C T missense Het probably benign 0.005 phenotype 04/05/2018
61 511271 UTSW Ndel1 1.000 FR4342 225.01 N 11 68833409 P246L G A missense Het probably damaging 0.966 phenotype 04/05/2018
62 511299 UTSW Nelfe 0.935 FR4342 217.47 N 17 34854089 AC ACAAAGAGCGGGATCGAGACAGAGCC unclassified Het probably benign phenotype 04/05/2018
63 511247 UTSW Olfr495 0.138 FR4342 150.01 N 7 108395893 T258A A G missense Het probably benign 0.000 phenotype 04/05/2018
64 511248 UTSW Olfr495 0.138 FR4342 126.01 N 7 108395898 M259I G A missense Het probably benign 0.000 phenotype 04/05/2018
65 511246 UTSW Olfr635 0.139 FR4342 217.47 N 7 103979903 TCC TCCC frame shift Het probably null phenotype 04/05/2018
66 511269 UTSW P4ha2 0.410 FR4342 214.46 N 11 54110251 GTGTTGCTG GTG small deletion Homo probably benign phenotype 04/05/2018
67 511296 UTSW Park2 0.225 FR4342 222.21 N 17 11854763 V323M G A missense Homo probably damaging 0.999 phenotype 04/05/2018
68 511249 UTSW Pde3b 0.000 FR4342 214.46 N 7 114534775 GGTGGTGGTG GGTGGTGGTGGTG small insertion Homo probably benign phenotype 04/05/2018
69 511223 UTSW Pdik1l 0.474 FR4342 214.49 N 4 134279509 ACCACC ACCACCCCCACC intron Homo probably benign 04/05/2018
70 511305 UTSW Plekhs1 0.039 FR4342 214.46 N 19 56479858 TCCAGAC TCCAGACCTCCCCCCAGAC unclassified Homo probably benign 04/05/2018
71 511306 UTSW Plekhs1 0.039 FR4342 214.46 N 19 56479861 AGAC AGACCTCCCCCGCGAC unclassified Homo probably benign 04/05/2018
72 511225 UTSW Pramef25 0.073 FR4342 108.01 N 4 143949742 T264M G A missense Het probably damaging 0.992 04/05/2018
73 511226 UTSW Pramef25 0.073 FR4342 109.47 N 4 143949757 AAGAG AAG frame shift Het probably null 04/05/2018
74 511238 UTSW Ptms FR4342 105.54 N 6 124914454 TCT TCTCCT unclassified Homo probably benign 04/05/2018
75 511262 UTSW Raet1d 0.046 FR4342 80.01 N 10 22371559 Q178R A G missense Het probably benign 0.000 04/05/2018
76 511253 UTSW Rtbdn 0.069 FR4342 133.47 N 8 84956168 AGCG AGCGCCGGCG small insertion Het probably benign phenotype 04/05/2018
77 511254 UTSW Rtbdn 0.069 FR4342 217.54 N 8 84956178 GC GCAGCGCC small insertion Het probably benign phenotype 04/05/2018
78 511295 UTSW Serac1 0.516 FR4342 222 N 17 6070808 K70N T A missense Homo probably damaging 1.000 phenotype 04/05/2018
79 511235 UTSW Sfswap 0.000 FR4342 215.1 N 5 129569757 CCCACTC CCCACTCAGACCACTC unclassified Homo probably benign phenotype 04/05/2018
80 511202 UTSW Sp110 0.372 FR4342 150.47 N 1 85587488 ACT ACTGCT small insertion Het probably benign 04/05/2018
81 511220 UTSW Spaca1 0.000 FR4342 217.47 N 4 34049838 GCTCTC GCTCTCACTCTC small insertion Het probably benign phenotype 04/05/2018
82 511217 UTSW Spag17 0.462 FR4342 181.47 N 3 100056249 GGA GGATGA small insertion Het probably benign phenotype 04/05/2018
83 511218 UTSW Spag17 0.462 FR4342 214.46 N 3 100056252 GGAGGAGGA GGAGGAGGAGGA small insertion Homo probably benign phenotype 04/05/2018
84 511230 UTSW Speer4a 0.036 FR4342 225.01 N 5 26036748 E127* C A nonsense Het probably null 04/05/2018
85 511307 UTSW Sry 0.336 FR4342 214.47 N Y 2662835 TGG TGGGGG small insertion Het probably benign phenotype 04/05/2018
86 511308 UTSW Sry 0.336 FR4342 214.47 N Y 2662836 GGT GGTTGT small insertion Het probably benign phenotype 04/05/2018
87 511309 UTSW Sry 0.336 FR4342 214.46 N Y 2662839 GGT GGTAGT small insertion Homo probably benign phenotype 04/05/2018
88 511310 UTSW Sry 0.336 FR4342 169.47 N Y 2663146 CTGCTGGTG CTG small deletion Het probably benign phenotype 04/05/2018
89 511215 UTSW Tdpoz3 0.721 FR4342 93.01 N 3 93826512 P165S C T missense Het probably benign 0.087 04/05/2018
90 511214 UTSW Tdpoz4 0.684 FR4342 145.47 N 3 93796880 GAA GA frame shift Het probably null 04/05/2018
91 511287 UTSW Tert 0.467 FR4342 214.46 N 13 73648300 AGGCC AGGCCAAGGGGGCC utr 3 prime Homo probably benign phenotype 04/05/2018
92 511229 UTSW Tmbim7 0.039 FR4342 222 N 5 3670064 R100C C T missense Homo possibly damaging 0.503 04/05/2018
93 511227 UTSW Tnfrsf9 0.107 FR4342 214.46 N 4 150934394 CT CTGAT intron Homo probably benign phenotype 04/05/2018
94 511276 UTSW Tob1 0.000 FR4342 217.47 N 11 94214472 AGC AGCCGC small insertion Het probably benign phenotype 04/05/2018
95 511291 UTSW Trav6n-5 FR4342 112.46 N 14 53104912 GCTT G small deletion Homo probably benign 04/05/2018
96 511292 UTSW Triobp 1.000 FR4342 202.47 N 15 78993392 G GTCA unclassified Homo probably benign phenotype 04/05/2018
97 511237 UTSW Tsen2 0.933 FR4342 207.47 N 6 115560072 AGG AGGTGG small insertion Het probably benign phenotype 04/05/2018
98 511281 UTSW Ubtf 0.972 FR4342 217.47 N 11 102306956 TCC TCCGCC small insertion Het probably benign phenotype 04/05/2018
99 511282 UTSW Ubtf 0.972 FR4342 217.47 N 11 102306959 TC TCCCC small insertion Het probably benign phenotype 04/05/2018
100 511228 UTSW Vmn2r125 0.046 FR4342 81.01 N 4 156350965 V213I G A missense Het probably benign 0.007 04/05/2018
[records 1 to 100 of 109] next >> last >|