Incidental Mutations

148 incidental mutations are currently displayed, and affect 120 genes.
4 are Possibly Damaging.
11 are Probably Damaging.
115 are Probably Benign.
16 are Probably Null.
4 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 148] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 512099 UTSW 1700001K19Rik 0.048 FR4548 214.47 N 12 110668449 CTT CTTTTT unclassified Het probably benign 04/05/2018
2 512100 UTSW 1700001K19Rik 0.048 FR4548 217.47 N 12 110668452 CTT CTTTTT unclassified Het probably benign 04/05/2018
3 512002 UTSW 2010300C02Rik 0.101 FR4548 222 N 1 37625035 E594V T A missense Homo probably benign 0.399 04/05/2018
4 512003 UTSW 2010300C02Rik 0.101 FR4548 222 N 1 37625036 E594* C A nonsense Homo probably null 04/05/2018
5 512004 UTSW 2010300C02Rik 0.101 FR4548 88 N 1 37625102 S47P A G missense Homo probably damaging 0.958 04/05/2018
6 512052 UTSW 4930433I11Rik 0.087 FR4548 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
7 512078 UTSW 4932415D10Rik 0.148 FR4548 214.46 N 10 82290996 G GTCATTA small insertion Homo probably benign 04/05/2018
8 512101 UTSW Abt1 0.959 FR4548 167.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
9 512028 UTSW Ahdc1 0.516 FR4548 214.46 N 4 133062757 TCC TCCCCC small insertion Homo probably benign phenotype 04/05/2018
10 512029 UTSW Ahdc1 0.516 FR4548 214.46 N 4 133062760 T TCCC small insertion Homo probably benign phenotype 04/05/2018
11 512139 UTSW AI837181 0.166 FR4548 131.47 N 19 5425231 CGG CGGGGG small insertion Het probably benign 04/05/2018
12 512140 UTSW AI837181 0.166 FR4548 132.49 N 19 5425237 CG CGGGG small insertion Het probably benign 04/05/2018
13 512069 UTSW Anxa2 0.000 FR4548 104.47 N 9 69480203 CCC CCCTCC small insertion Het probably benign phenotype 04/05/2018
14 512105 UTSW Anxa7 0.095 FR4548 222 N 14 20469411 G113E C T missense Homo probably damaging 0.967 0.040 phenotype 04/05/2018
15 512138 UTSW Apc 0.987 FR4548 217.47 N 18 34281998 CCAATAAAG CCAATAAAGACAATAAAG intron Het probably benign phenotype 04/05/2018
16 512117 UTSW Apol6 0.028 FR4548 214.46 N 15 77051445 T TGTTA frame shift Homo probably null phenotype 04/05/2018
17 512130 UTSW BC051142 0.079 FR4548 157.47 N 17 34460065 GCA GCATCA unclassified Het probably benign 04/05/2018
18 512054 UTSW Blm 1.000 FR4548 214.46 N 7 80463769 CTAC CTACTTAC frame shift Homo probably null phenotype 04/05/2018
19 512129 UTSW Brd2 1.000 FR4548 217.47 N 17 34116336 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAAAAA unclassified Het probably benign phenotype 04/05/2018
20 512042 UTSW Bud31 0.942 FR4548 82.01 N 5 145146535 R63C C T missense Het probably benign 0.022 04/05/2018
21 512131 UTSW C4b 0.000 FR4548 119.01 N 17 34740997 R335H C T missense Het probably benign 0.002 phenotype 04/05/2018
22 512062 UTSW Cacna1a 0.756 FR4548 217.47 N 8 84638717 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
23 512147 UTSW Cacna1f 0.352 FR4548 137.47 N X 7620058 AGG AGGGGG utr 3 prime Het probably benign phenotype 04/05/2018
24 512075 UTSW Ccdc170 0.239 FR4548 118.47 N 10 4561026 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
25 512058 UTSW Cckbr 0.061 FR4548 146.51 N 7 105434681 GGGC G small deletion Homo probably benign phenotype 04/05/2018
26 512049 UTSW Cd3eap 0.803 FR4548 130.46 N 7 19357244 GGATG GG unclassified Homo probably benign 04/05/2018
27 512124 UTSW Cd80 0.126 FR4548 207.54 N 16 38486319 GAAA GAAAAAA small insertion Homo probably benign phenotype 04/05/2018
28 512063 UTSW Ces1b 0.058 FR4548 89.01 N 8 93068092 N293S T C missense Homo probably null 0.000 04/05/2018
29 512070 UTSW Cgnl1 0.217 FR4548 212.47 N 9 71724717 CGC CGCGGC small insertion Het probably benign phenotype 04/05/2018
30 512092 UTSW Cntnap1 0.519 FR4548 217.47 N 11 101189572 CCCAGC CCCAGCGCCAGC unclassified Het probably benign phenotype 04/05/2018
31 512093 UTSW Cntnap1 0.519 FR4548 217.47 N 11 101189579 CCAGCC CCAGCCTCAGCC unclassified Het probably benign phenotype 04/05/2018
32 512094 UTSW Cntnap1 0.519 FR4548 217.47 N 11 101189593 AGCC AGCCCCCGCC unclassified Het probably benign phenotype 04/05/2018
33 512095 UTSW Cntnap1 0.519 FR4548 217.47 N 11 101189594 GCC GCCCCAACC unclassified Het probably benign phenotype 04/05/2018
34 512103 UTSW Ctsm 0.052 FR4548 214.46 N 13 61537837 GTGA GTGAATGA frame shift Homo probably null 04/05/2018
35 512043 UTSW Cttnbp2 0.264 FR4548 217.47 N 6 18367463 TGCTGC TGCTGCCGCTGC utr 3 prime Het probably benign phenotype 04/05/2018
36 512072 UTSW Dbr1 0.909 FR4548 217.47 N 9 99583673 GAGGAG GAGGAGTAGGAG nonsense Het probably null phenotype 04/05/2018
37 512007 UTSW Dusp10 0.366 FR4548 222 N 1 184037056 C73F G T missense Homo probably damaging 0.996 0.268 phenotype 04/05/2018
38 512018 UTSW Efna4 FR4548 214.46 N 3 89334422 ATGTGAT A unclassified Homo probably benign phenotype 04/05/2018
39 512144 UTSW Eif3a 0.973 FR4548 214.46 N 19 60775291 A ATTTTT critical splice donor site Homo probably benign 04/05/2018
40 512008 UTSW Ermn 0.124 FR4548 205.47 N 2 58048075 TTC TTCATC unclassified Het probably benign 04/05/2018
41 512009 UTSW Ermn 0.124 FR4548 217.47 N 2 58048088 TC TCTCC unclassified Het probably benign 04/05/2018
42 512116 UTSW Fbxo43 0.328 FR4548 217.47 N 15 36152098 GTGCCT GTGCCTATGCCT nonsense Het probably null phenotype 04/05/2018
43 512097 UTSW Fscb 0.078 FR4548 107.01 N 12 64472563 S710P A G missense Het unknown 04/05/2018
44 512098 UTSW Fscb 0.078 FR4548 113.01 N 12 64472565 Q709L T A missense Het unknown 04/05/2018
45 512087 UTSW Glod4 0.203 FR4548 104.51 N 11 76243310 A C start gained Homo probably benign 04/05/2018
46 512013 UTSW Gm14401 0.192 FR4548 87.01 N 2 177086868 D249G A G missense Het probably benign 0.000 04/05/2018
47 512079 UTSW Gm4340 FR4548 164.47 N 10 104196070 AGC AGCCGC small insertion Het probably benign 04/05/2018
48 512080 UTSW Gm4340 FR4548 193.47 N 10 104196073 AGC AGCGGC small insertion Het probably benign 04/05/2018
49 512107 UTSW Gm8104 0.243 FR4548 93.01 N 14 43110009 T178I C T missense Het probably benign 0.048 04/05/2018
50 512108 UTSW Gm8104 0.243 FR4548 95.01 N 14 43110011 S179P T C missense Het probably damaging 0.984 04/05/2018
51 512136 UTSW Gpatch11 0.214 FR4548 217.47 N 17 78842175 GGAAGA GGAAGACGAAGA small insertion Het probably benign 04/05/2018
52 512128 UTSW H2-K1 0.118 FR4548 202.46 N 17 33997042 GTTT G unclassified Homo probably benign phenotype 04/05/2018
53 512102 UTSW Hist1h1t 0.000 FR4548 133.46 N 13 23695920 GAGAA GA unclassified Homo probably benign phenotype 04/05/2018
54 512133 UTSW Hspa1b 0.278 FR4548 122.46 N 17 34957129 GCGCC GC small deletion Homo probably benign phenotype 04/05/2018
55 512006 UTSW Ifi211 0.189 FR4548 87.01 N 1 173906193 A134V G A missense Het possibly damaging 0.852 phenotype 04/05/2018
56 512053 UTSW Igf1r 1.000 FR4548 217.51 N 7 68226186 C CTGGAGATGGAGG small insertion Het probably benign phenotype 04/05/2018
57 512044 UTSW Igkv9-129 FR4548 85.01 N 6 67840034 V41I G A missense Het probably damaging 1.000 04/05/2018
58 512005 UTSW Ipo9 1.000 FR4548 217.47 N 1 135386275 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
59 512064 UTSW Kcng4 0.020 FR4548 222 N 8 119633519 Y39* G T nonsense Homo probably null 0.660 phenotype 04/05/2018
60 512048 UTSW Klra2 0.020 FR4548 217.47 N 6 131221851 AG AGAAATCCACGG frame shift Het probably null phenotype 04/05/2018
61 512051 UTSW Kmt2b 1.000 FR4548 217.47 N 7 30586380 CTCC CTCCTCGTCC unclassified Het probably benign phenotype 04/05/2018
62 512123 UTSW Kng2 0.160 FR4548 225.01 N 16 23000552 Q245* G A nonsense Het probably null 04/05/2018
63 512068 UTSW Kri1 0.900 FR4548 217.47 N 9 21281050 CTCCTCTTCCTC CTCCTC small deletion Het probably benign phenotype 04/05/2018
64 512090 UTSW Krt10 0.337 FR4548 217.47 N 11 99389273 TCCTCC TCCTCCCCCTCC unclassified Het probably benign phenotype 04/05/2018
65 512091 UTSW Krt10 0.337 FR4548 214.46 N 11 99389276 TCCTCCAC TCCTCCACCTCCAC unclassified Homo probably benign phenotype 04/05/2018
66 512148 UTSW Las1l FR4548 217.47 N X 95940625 TC TCTTCCGC small insertion Het probably benign 04/05/2018
67 512149 UTSW Las1l FR4548 204.47 N X 95940823 GAG GAGAAG small insertion Het probably benign 04/05/2018
68 512021 UTSW Lrit3 0.233 FR4548 217.47 N 3 129788813 GCT GCTACT small insertion Het probably benign phenotype 04/05/2018
69 512022 UTSW Lrit3 0.233 FR4548 217.47 N 3 129788816 GCT GCTACT small insertion Het probably benign phenotype 04/05/2018
70 512112 UTSW Lrrc63 0.158 FR4548 214.46 N 14 75125182 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG small deletion Homo probably benign 04/05/2018
71 512031 UTSW Luzp1 1.000 FR4548 214.46 N 4 136543188 CTCTTCAGA CTCTTCAGAGGTGGCATCTTCAGA small insertion Homo probably benign phenotype 04/05/2018
72 512104 UTSW Mast4 0.518 FR4548 214.54 N 13 102736318 CA CAGTGGGA small insertion Homo probably benign phenotype 04/05/2018
73 512017 UTSW Med12l 0.503 FR4548 186.47 N 3 59275982 AGC AGCGGC small insertion Het probably benign phenotype 04/05/2018
74 512039 UTSW Mn1 0.000 FR4548 165.47 N 5 111419698 GCA GCACCA small insertion Het probably benign phenotype 04/05/2018
75 512143 UTSW Morn4 0.131 FR4548 217.47 N 19 42076109 AGGCAGTGAG AGGCAGTGAGTCCGGCAGTGAG small insertion Het probably benign 04/05/2018
76 512066 UTSW Msantd4 0.359 FR4548 222 N 9 4384937 I221F A T missense Homo possibly damaging 0.505 04/05/2018
77 512025 UTSW Mup21 0.060 FR4548 217.47 N 4 62149345 TATACTT TATACTTTTTAAATACTT critical splice donor site Het probably benign 04/05/2018
78 512026 UTSW Mup21 0.060 FR4548 217.47 N 4 62149346 ATACTT ATACTTTTTATCTACTT critical splice donor site Het probably benign 04/05/2018
79 512081 UTSW Nacad 0.381 FR4548 217.47 N 11 6599752 AGGGTC AGGGTCGGGGTC small insertion Het probably benign 04/05/2018
80 512082 UTSW Nacad 0.381 FR4548 207.47 N 11 6599760 GG GGCCAGTG small insertion Het probably benign 04/05/2018
81 512047 UTSW Ncapd2 0.980 FR4548 214.46 N 6 125173596 CTT CTTGGTT critical splice donor site Homo probably benign 04/05/2018
82 512132 UTSW Nelfe 0.935 FR4548 214.46 N 17 34854070 GACCGGGATCGAGACAGAGAC GACCGGGATCGAGACAGAGACAAAGACCGGGATCGAGACAGAGAC unclassified Homo probably benign phenotype 04/05/2018
83 512038 UTSW Nfxl1 0.251 FR4548 217.55 N 5 72559115 CCGGGG CCGGGGTCGGGG small insertion Het probably benign 04/05/2018
84 512111 UTSW Nkx2-6 0.000 FR4548 205.07 N 14 69175229 T282M C T missense Homo probably damaging 0.996 phenotype 04/05/2018
85 512035 UTSW Noc2l 1.000 FR4548 106.46 N 4 156240092 AGGC AGGCGGC small insertion Homo probably benign phenotype 04/05/2018
86 512036 UTSW Noc2l 1.000 FR4548 123.47 N 4 156240100 GC GCTTC small insertion Het probably benign phenotype 04/05/2018
87 512073 UTSW Nphp3 1.000 FR4548 180.47 N 9 104025939 CACG C small deletion Het probably benign phenotype 04/05/2018
88 512106 UTSW Nrg3 0.484 FR4548 214.46 N 14 38397271 TTG TTGACACTG small insertion Homo probably benign phenotype 04/05/2018
89 512086 UTSW Olfr313 0.065 FR4548 151 N 11 58817440 V144D T A missense Homo possibly damaging 0.797 0.182 phenotype 04/05/2018
90 512085 UTSW Olfr318 0.122 FR4548 93.01 N 11 58720371 I226L T G missense Het probably benign 0.000 phenotype 04/05/2018
91 512055 UTSW Olfr585 0.058 FR4548 214.46 N 7 103098309 T TTAG nonsense Homo probably null phenotype 04/05/2018
92 512056 UTSW Olfr624 0.215 FR4548 214.46 N 7 103670960 CAAA CAAAAAA small insertion Homo probably benign phenotype 04/05/2018
93 512057 UTSW Olfr624 0.215 FR4548 214.46 N 7 103670967 G GAAC nonsense Homo probably null phenotype 04/05/2018
94 512114 UTSW Osmr 0.077 FR4548 214.97 N 15 6837703 CTC CTCTTC small insertion Homo probably benign phenotype 04/05/2018
95 512010 UTSW Patl2 0.249 FR4548 217.47 N 2 122126135 GCT GCTCCT small insertion Het probably benign 04/05/2018
96 512030 UTSW Pdik1l 0.474 FR4548 214.46 N 4 134279512 ACCAC ACCACCGCCAC intron Homo probably benign 04/05/2018
97 512050 UTSW Phldb3 0.132 FR4548 217.47 N 7 24628978 GACCC G makesense Het probably null 04/05/2018
98 512065 UTSW Piezo1 1.000 FR4548 222 N 8 122495569 R503W G A missense Homo probably damaging 1.000 0.400 phenotype 04/05/2018
99 512141 UTSW Pik3ap1 0.000 FR4548 214.46 N 19 41281945 AG AGGGG small insertion Homo probably benign phenotype 04/05/2018
100 512121 UTSW Pkdrej 0.142 FR4548 214.46 N 15 85819680 TG TGGGAGCG small insertion Homo probably benign phenotype 04/05/2018
[records 1 to 100 of 148] next >> last >|