Incidental Mutations

127 incidental mutations are currently displayed, and affect 100 genes.
2 are Possibly Damaging.
7 are Probably Damaging.
98 are Probably Benign.
18 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 127] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511319 UTSW 4930402H24Rik 0.210 FR4589 203.47 N 2 130770745 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
2 511320 UTSW 4930402H24Rik 0.210 FR4589 142.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
3 511339 UTSW 4930548H24Rik 0.106 FR4589 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
4 511414 UTSW 7530416G11Rik 0.296 FR4589 222 N 15 85494307 E45V T A missense Homo unknown 04/05/2018
5 511426 UTSW A530064D06Rik 0.000 FR4589 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
6 511365 UTSW Anxa2 0.000 FR4589 149.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
7 511413 UTSW Apol6 0.028 FR4589 217.47 N 15 77051438 GTTT GTTTTTTT frame shift Het probably null phenotype 04/05/2018
8 511385 UTSW Arrb2 0.000 FR4589 222 N 11 70438671 T269M C T missense Homo probably damaging 1.000 phenotype 04/05/2018
9 511357 UTSW AY761185 0.057 FR4589 217.47 N 8 20943903 CACTGTGGG C frame shift Het probably null 04/05/2018
10 511420 UTSW BC051142 0.079 FR4589 128.47 N 17 34460053 GCA GCACCA unclassified Het probably benign 04/05/2018
11 511421 UTSW BC051142 0.079 FR4589 155.47 N 17 34460073 AGC AGCCGC unclassified Het probably benign 04/05/2018
12 511387 UTSW Bcas3 0.537 FR4589 222 N 11 85509497 V431I G A missense Homo probably benign 0.115 04/05/2018
13 511354 UTSW Blm 1.000 FR4589 217.47 N 7 80463770 TACC TACCGACC frame shift Het probably null phenotype 04/05/2018
14 511382 UTSW Btnl10 0.140 FR4589 214.46 N 11 58923929 AGA AGAGGA small insertion Homo probably benign 04/05/2018
15 511422 UTSW Btnl4 0.139 FR4589 103.01 N 17 34472636 K293M T A missense Het probably benign 0.304 04/05/2018
16 511317 UTSW Catsper2 0.233 FR4589 217.58 N 2 121397779 TGTC TGTCGTC utr 3 prime Het probably benign phenotype 04/05/2018
17 511367 UTSW Cd109 0.000 FR4589 180.47 N 9 78712529 ATTTAT ATTTATTTATTTCTTTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
18 511375 UTSW Cd164 0.146 FR4589 222 N 10 41521926 A59S G T missense Homo probably benign 0.003 0.153 phenotype 04/05/2018
19 511353 UTSW Cd22 0.000 FR4589 222 N 7 30878082 R2H C T missense Homo possibly damaging 0.948 0.074 phenotype 04/05/2018
20 511344 UTSW Chd4 0.982 FR4589 116.26 N 6 125122133 P1597L C T missense Homo probably benign 0.020 phenotype 04/05/2018
21 511345 UTSW Chd4 0.982 FR4589 214.46 N 6 125122139 CCCCTGCCCCTGCCACTGCCCCTGCC CCCCTGCCCCTGCCCCTGCCACTGCCCCTGCC unclassified Homo probably benign phenotype 04/05/2018
22 511398 UTSW Chga 0.150 FR4589 116.47 N 12 102561402 AGC AGCTGC small insertion Het probably benign phenotype 04/05/2018
23 511386 UTSW Cluh 0.599 FR4589 217.47 N 11 74669531 AGCC AGCCTGGGCC small insertion Het probably benign phenotype 04/05/2018
24 511425 UTSW Cnpy3 1.000 FR4589 217.47 N 17 46736739 ACCC ACCCCCC utr 3 prime Het probably benign phenotype 04/05/2018
25 511391 UTSW Cntnap1 0.519 FR4589 217.47 N 11 101189566 CCCAGC CCCAGCTCCAGC unclassified Het probably benign phenotype 04/05/2018
26 511392 UTSW Cntnap1 0.519 FR4589 217.47 N 11 101189575 AGCCCC AGCCCCCGCCCC unclassified Het probably benign phenotype 04/05/2018
27 511393 UTSW Cntnap1 0.519 FR4589 217.47 N 11 101189580 CAGCCC CAGCCCGAGCCC unclassified Het probably benign phenotype 04/05/2018
28 511394 UTSW Cntnap1 0.519 FR4589 217.47 N 11 101189581 AGCCCC AGCCCCCGCCCC unclassified Het probably benign phenotype 04/05/2018
29 511415 UTSW Col2a1 1.000 FR4589 225.01 N 15 97988981 C A synonymous Het probably null 0.639 phenotype 04/05/2018
30 511373 UTSW Col6a5 0.907 FR4589 222 N 9 105934174 N715K A T missense Homo unknown phenotype 04/05/2018
31 511342 UTSW Cttnbp2 0.264 FR4589 217.47 N 6 18367458 ATT ATTTCTGTT utr 3 prime Het probably benign phenotype 04/05/2018
32 511360 UTSW D230025D16Rik 0.233 FR4589 222 N 8 105241098 G207E G A missense Homo probably benign 0.000 04/05/2018
33 511368 UTSW Dbr1 0.909 FR4589 217.47 N 9 99583677 AGGAGG AGGAGGGGGAGG unclassified Het probably benign phenotype 04/05/2018
34 511369 UTSW Dbr1 0.909 FR4589 217.47 N 9 99583680 AGGAGG AGGAGGGGGAGG unclassified Het probably benign phenotype 04/05/2018
35 511370 UTSW Dbr1 0.909 FR4589 217.47 N 9 99583683 AGGAGG AGGAGGCGGAGG unclassified Het probably benign phenotype 04/05/2018
36 511371 UTSW Dbr1 0.909 FR4589 217.47 N 9 99583696 GGAGGA GGAGGAAGAGGA unclassified Het probably benign phenotype 04/05/2018
37 511430 UTSW Dclre1a 0.000 FR4589 217.68 N 19 56544123 AGGCTTTG AG utr 3 prime Het probably benign phenotype 04/05/2018
38 511418 UTSW Dcpp1 0.127 FR4589 91.01 N 17 23881454 K53Q A C missense Het probably benign 0.000 04/05/2018
39 511395 UTSW Dhx8 0.973 FR4589 214.46 N 11 101738188 CGAGAC CGAGACAGAGAC small insertion Homo probably benign phenotype 04/05/2018
40 511404 UTSW Dnah12 0.587 FR4589 222 N 14 26849385 G2817V G T missense Homo probably damaging 1.000 0.039 04/05/2018
41 511340 UTSW Dthd1 0.254 FR4589 128.59 N 5 62843026 C CTT frame shift Homo probably null phenotype 04/05/2018
42 511336 UTSW Efhd2 0.170 FR4589 185.47 N 4 141874764 GCCGCC GCCGCCTCCGCC small insertion Het probably benign phenotype 04/05/2018
43 511347 UTSW Eps8 0.274 FR4589 217.47 N 6 137517069 AC ACTCGC frame shift Het probably null phenotype 04/05/2018
44 511313 UTSW Ermn 0.124 FR4589 217.47 N 2 58048069 TTC TTCATC unclassified Het probably benign 04/05/2018
45 511403 UTSW Fam81b 0.099 FR4589 217.47 N 13 76271323 TC TCTCC small insertion Het probably benign 04/05/2018
46 511341 UTSW Fbrsl1 0.230 FR4589 217.47 N 5 110378150 TG TGCGTGTGCTGGCG small insertion Het probably benign 04/05/2018
47 511411 UTSW Fbxo43 0.328 FR4589 217.47 N 15 36152100 GCCTGT GCCTGTTCCTGT small insertion Het probably benign phenotype 04/05/2018
48 511412 UTSW Fbxo43 0.328 FR4589 217.47 N 15 36152101 CCTGTG CCTGTGTCTGTG small insertion Het probably benign phenotype 04/05/2018
49 511314 UTSW Fmn1 0.405 FR4589 217.47 N 2 113525773 CTCCTC CTCCTCTTCCTC small insertion Het probably benign phenotype 04/05/2018
50 511315 UTSW Fmn1 0.405 FR4589 217.5 N 2 113525774 TCCTCC TCCTCCCCCTCC small insertion Het probably benign phenotype 04/05/2018
51 511405 UTSW Frmpd2 0.168 FR4589 222 N 14 33511021 L399F G T missense Homo probably damaging 1.000 phenotype 04/05/2018
52 511432 UTSW Gabre FR4589 175.59 N X 72270030 GCTCCGACTCCGACTCCG GCTCCGACTCCGACTCCGACTCCG small insertion Homo probably benign 04/05/2018
53 511433 UTSW Gabre FR4589 175.59 N X 72270042 ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC small insertion Homo probably benign 04/05/2018
54 511332 UTSW Gbp2b 0.000 FR4589 95.01 N 3 142603652 I175V A G missense Het probably benign 0.002 phenotype 04/05/2018
55 511400 UTSW Gm10324 FR4589 87.01 N 13 66122208 S396N G A missense Het probably benign 0.196 04/05/2018
56 511376 UTSW Gm4340 FR4589 216.47 N 10 104196078 CAG CAGTAG nonsense Het probably null 04/05/2018
57 511377 UTSW Gm4340 FR4589 181.47 N 10 104196079 AGC AGCCGC small insertion Het probably benign 04/05/2018
58 511378 UTSW Gm4340 FR4589 194.47 N 10 104196100 AG AGCCG small insertion Het probably benign 04/05/2018
59 511424 UTSW H2-Q4 0.021 FR4589 225.01 N 17 35380405 D155N G A missense Het probably damaging 1.000 0.032 phenotype 04/05/2018
60 511399 UTSW Ighv5-9 0.116 FR4589 222 N 12 113661877 S82N C T missense Homo probably benign 0.017 0.100 04/05/2018
61 511311 UTSW Ipo9 1.000 FR4589 217.47 N 1 135386266 CCATC CCATCATC small insertion Het probably benign phenotype 04/05/2018
62 511312 UTSW Ipo9 1.000 FR4589 210.47 N 1 135386281 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
63 511326 UTSW Isg20l2 0.912 FR4589 195.46 N 3 87931717 GAAA GAAAAAA unclassified Homo probably benign phenotype 04/05/2018
64 511346 UTSW Klra9 0.073 FR4589 83.01 N 6 130182403 D216H C G missense Het probably benign 0.372 04/05/2018
65 511350 UTSW Kmt2b 1.000 FR4589 217.47 N 7 30586361 CCTCCT CCTCCTGCTCCT unclassified Het probably benign phenotype 04/05/2018
66 511351 UTSW Kmt2b 1.000 FR4589 217.47 N 7 30586364 CCTCCT CCTCCTACTCCT nonsense Het probably null phenotype 04/05/2018
67 511352 UTSW Kmt2b 1.000 FR4589 217.47 N 7 30586381 TCC TCCTCCGCC unclassified Het probably benign phenotype 04/05/2018
68 511390 UTSW Krt10 0.337 FR4589 167.47 N 11 99389276 TCC TCCGCCGCC unclassified Het probably benign phenotype 04/05/2018
69 511434 UTSW Las1l FR4589 217.47 N X 95940619 TCTTCC TCTTCCGCTTCC small insertion Het probably benign 04/05/2018
70 511435 UTSW Las1l FR4589 121.47 N X 95940621 TTCCTCCTCCTC TTCCTC small deletion Het probably benign 04/05/2018
71 511436 UTSW Las1l FR4589 217.47 N X 95940625 TC TCTTCCAC small insertion Het probably benign 04/05/2018
72 511328 UTSW Lce1m FR4589 214.46 N 3 93018268 TGCTGCCACC TGCTGCCACCACGGCTGCCACC unclassified Homo probably benign 04/05/2018
73 511327 UTSW Lor 0.224 FR4589 217.47 N 3 92081894 GCCGCCGCC GC frame shift Het probably null phenotype 04/05/2018
74 511331 UTSW Lrit3 0.233 FR4589 217.64 N 3 129803913 AC ACATCC frame shift Het probably null phenotype 04/05/2018
75 511407 UTSW Lrrc63 0.158 FR4589 214.46 N 14 75125182 CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG small deletion Homo probably benign 04/05/2018
76 511383 UTSW Mapk7 1.000 FR4589 176.8 N 11 61490222 GG GGTGCTAG intron Het probably benign phenotype 04/05/2018
77 511325 UTSW Med12l 0.503 FR4589 150.47 N 3 59275956 GCAACA GCAACAACA small insertion Het probably benign phenotype 04/05/2018
78 511380 UTSW Nacad 0.381 FR4589 217.47 N 11 6599753 GGGTCA GGGTCATGGTCA small insertion Het probably benign 04/05/2018
79 511355 UTSW Ndufc2 0.081 FR4589 82.01 N 7 97400290 M34I G C missense Het probably benign 0.000 04/05/2018
80 511372 UTSW Nphp3 1.000 FR4589 202.47 N 9 104025939 CACG C small deletion Het probably benign phenotype 04/05/2018
81 511406 UTSW Nrg3 0.484 FR4589 177.47 N 14 38397266 AG AGCCTTTG small insertion Het probably benign phenotype 04/05/2018
82 511334 UTSW Pdik1l 0.474 FR4589 214.46 N 4 134279368 TTTTTGTTTT TTTTTGTTTTGATTTTGTTTT frame shift Homo probably null 04/05/2018
83 511335 UTSW Pdik1l 0.474 FR4589 214.46 N 4 134279369 TTTTGTTTT TTTTGTTTTGTGTTTGTTTT frame shift Homo probably null 04/05/2018
84 511429 UTSW Plekhs1 0.039 FR4589 217.47 N 19 56479863 AC ACCTCCCCCGAGGC unclassified Het probably benign 04/05/2018
85 511358 UTSW Prag1 0.311 FR4589 214.46 N 8 36103883 CCGC CCGCCGC small insertion Homo probably benign phenotype 04/05/2018
86 511366 UTSW Prtg 0.428 FR4589 225.01 N 9 72856865 R540Q G A missense Het probably damaging 1.000 phenotype 04/05/2018
87 511374 UTSW Raet1d 0.046 FR4589 214.46 N 10 22370918 T TCCTCTCTGGTAG nonsense Homo probably null 04/05/2018
88 511381 UTSW Rhbdf1 0.501 FR4589 100.47 N 11 32214391 A ATTTT unclassified Het probably benign phenotype 04/05/2018
89 511349 UTSW Rps19 1.000 FR4589 217.47 N 7 24889182 AAAATT AAAATTGAAATT unclassified Het probably benign phenotype 04/05/2018
90 511359 UTSW Rtbdn 0.069 FR4589 217.47 N 8 84956171 GGCAGC GGCAGCCGCAGC small insertion Het probably benign phenotype 04/05/2018
91 511416 UTSW Scaf4 0.486 FR4589 140.46 N 16 90229854 TGCGGC TGC small deletion Homo probably benign phenotype 04/05/2018
92 511417 UTSW Serac1 0.154 FR4589 222 N 17 6070808 K70N T A missense Homo probably damaging 1.000 phenotype 04/05/2018
93 511356 UTSW Setd1a 1.000 FR4589 217.47 N 7 127785297 CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG unclassified Het probably benign phenotype 04/05/2018
94 511318 UTSW Shf 0.092 FR4589 214.46 N 2 122354177 TCT TCTGCT small insertion Homo probably benign 04/05/2018
95 511431 UTSW Shroom4 0.179 FR4589 104.49 N X 6624061 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA small deletion Homo probably benign phenotype 04/05/2018
96 511427 UTSW Six3 1.000 FR4589 184.47 N 17 85621365 CGG CGGAGG small insertion Het probably benign phenotype 04/05/2018
97 511364 UTSW Snx1 0.000 FR4589 214.46 N 9 66104926 TCT TCTCCT small insertion Homo probably benign phenotype 04/05/2018
98 511329 UTSW Spag17 0.462 FR4589 217.47 N 3 100056245 AGG AGGGGG small insertion Het probably benign phenotype 04/05/2018
99 511330 UTSW Spag17 0.462 FR4589 217.47 N 3 100056258 GGA GGATGA small insertion Het probably benign phenotype 04/05/2018
100 511338 UTSW Speer4a 0.036 FR4589 225.01 N 5 26036748 E127* C A nonsense Het probably null 04/05/2018
[records 1 to 100 of 127] next >> last >|