Incidental Mutations

223 incidental mutations are currently displayed, and affect 155 genes.
4 are Possibly Damaging.
13 are Probably Damaging.
180 are Probably Benign.
25 are Probably Null.
2 create premature stop codons.
9 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 223] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 511925 UTSW 1700001K19Rik 0.048 FR4976 201.47 N 12 110668447 TTC TTCATC unclassified Het probably benign 04/05/2018
2 511926 UTSW 1700001K19Rik 0.048 FR4976 187.47 N 12 110668450 TTC TTCGTC unclassified Het probably benign 04/05/2018
3 511780 UTSW 2010300C02Rik 0.101 FR4976 222 N 1 37625035 E594V T A missense Homo probably benign 0.399 04/05/2018
4 511781 UTSW 2010300C02Rik 0.101 FR4976 222 N 1 37625036 E594* C A nonsense Homo probably null 04/05/2018
5 511782 UTSW 2010300C02Rik 0.101 FR4976 82 N 1 37625102 S47P A G missense Homo probably damaging 0.958 04/05/2018
6 511807 UTSW 4930402H24Rik 0.210 FR4976 150.47 N 2 130770739 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
7 511808 UTSW 4930402H24Rik 0.210 FR4976 147.47 N 2 130770742 TCC TCCACC small insertion Het probably benign phenotype 04/05/2018
8 511809 UTSW 4930402H24Rik 0.210 FR4976 135.47 N 2 130770753 C CTCG small insertion Het probably benign phenotype 04/05/2018
9 511928 UTSW Abt1 0.959 FR4976 115.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
10 511980 UTSW AI837181 0.166 FR4976 111.47 N 19 5425229 GGC GGCCGC small insertion Het probably benign 04/05/2018
11 511897 UTSW Akap12 0.161 FR4976 218.26 N 10 4353837 AAA AAACAA small insertion Het probably benign phenotype 04/05/2018
12 511948 UTSW Alg1 0.228 FR4976 214.97 N 16 5244561 GCTCACTCAC GCTCAC frame shift Homo probably null phenotype 04/05/2018
13 511887 UTSW Alg9 0.212 FR4976 124.57 N 9 50775431 G GCGA unclassified Het probably benign phenotype 04/05/2018
14 511882 UTSW Amfr 0.476 FR4976 128.6 N 8 94012292 GCC GCCGGCGCGAGCTCC unclassified Het probably benign phenotype 04/05/2018
15 511792 UTSW Anapc2 1.000 FR4976 217.47 N 2 25272532 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG unclassified Het probably benign phenotype 04/05/2018
16 511936 UTSW Anxa7 0.095 FR4976 222 N 14 20469411 G113E C T missense Homo probably damaging 0.967 0.040 phenotype 04/05/2018
17 511973 UTSW Apc 0.987 FR4976 217.47 N 18 34281998 CCAATAAAG CCAATAAAGTCAATAAAG intron Het probably benign phenotype 04/05/2018
18 511974 UTSW Apc 0.987 FR4976 217.47 N 18 34282000 AATAAAGC AATAAAGCCTATAAAGC intron Het probably benign phenotype 04/05/2018
19 511975 UTSW Apc 0.987 FR4976 217.47 N 18 34282004 AAGC AAGCCAATATAGC nonsense Het probably null phenotype 04/05/2018
20 511836 UTSW Atad3a 1.000 FR4976 222 N 4 155753939 R207L C A missense Homo probably damaging 0.983 phenotype 04/05/2018
21 511956 UTSW BC051142 0.079 FR4976 211.47 N 17 34460058 AGC AGCGGC unclassified Het probably benign 04/05/2018
22 511957 UTSW BC051142 0.079 FR4976 187.47 N 17 34460061 AGC AGCGGC unclassified Het probably benign 04/05/2018
23 511868 UTSW Blm 1.000 FR4976 214.49 N 7 80463767 ACCT ACCTCCCT unclassified Homo probably benign phenotype 04/05/2018
24 511869 UTSW Blm 1.000 FR4976 217.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
25 511891 UTSW Bmp5 0.530 FR4976 216.23 N 9 75776375 GAGGAGT G small deletion Homo probably benign phenotype 04/05/2018
26 511810 UTSW Bpifa6 0.078 FR4976 99.07 N 2 153986376 Q134L A T missense Homo probably benign 0.000 04/05/2018
27 511811 UTSW Bpifa6 0.078 FR4976 90.13 N 2 153986398 R141S A T missense Homo probably benign 0.000 04/05/2018
28 511909 UTSW Btnl10 0.140 FR4976 212.47 N 11 58923929 AGA AGAGGA small insertion Homo probably benign 04/05/2018
29 511880 UTSW Cacna1a 0.756 FR4976 217.47 N 8 84638717 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
30 511881 UTSW Cacna1a 0.756 FR4976 217.73 N 8 84638726 ACC ACCTCC small insertion Het probably benign phenotype 04/05/2018
31 511984 UTSW Calhm1 0.403 FR4976 217.47 N 19 47141262 TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG unclassified Het probably benign phenotype 04/05/2018
32 511799 UTSW Catsper2 0.233 FR4976 214.46 N 2 121397542 C CTTTTACTTTTTT utr 3 prime Homo probably benign phenotype 04/05/2018
33 511800 UTSW Catsper2 0.233 FR4976 214.46 N 2 121397779 TGTC TGTCGTC utr 3 prime Homo probably benign phenotype 04/05/2018
34 511801 UTSW Catsper2 0.233 FR4976 217.47 N 2 121397782 CAT CATTAT utr 3 prime Het probably benign phenotype 04/05/2018
35 511802 UTSW Catsper2 0.233 FR4976 207.47 N 2 121397795 ATCGTCGTCGTC ATCGTCGTCGTCGTC utr 3 prime Het probably benign phenotype 04/05/2018
36 511898 UTSW Ccdc170 0.239 FR4976 142.47 N 10 4561008 ACCGCC ACCGCCGCC small insertion Het probably benign phenotype 04/05/2018
37 511899 UTSW Ccdc170 0.239 FR4976 170.47 N 10 4561023 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
38 511900 UTSW Ccdc170 0.239 FR4976 173.88 N 10 4561029 AC ACCTC small insertion Het probably benign phenotype 04/05/2018
39 511923 UTSW Ccnk 1.000 FR4976 217.47 N 12 108202507 TTCCCAC T unclassified Het probably benign phenotype 04/05/2018
40 511976 UTSW Cdx1 0.608 FR4976 217.47 N 18 61019867 GGGCTGC GGGCTGCGGCTGC small insertion Het probably benign phenotype 04/05/2018
41 511977 UTSW Cdx1 0.608 FR4976 217.47 N 18 61019869 GCTGCT GCTGCTTCTGCT small insertion Het probably benign phenotype 04/05/2018
42 511920 UTSW Cep112 0.329 FR4976 139.47 N 11 108425352 G GCTCT unclassified Het probably benign phenotype 04/05/2018
43 511865 UTSW Cep89 0.678 FR4976 186.47 N 7 35409641 GACT G utr 3 prime Het probably benign 04/05/2018
44 511877 UTSW Cfap46 0.064 FR4976 109.97 N 7 139638930 CCTTCT CCTTCTTCT utr 3 prime Homo probably benign 04/05/2018
45 511852 UTSW Chd4 0.982 FR4976 214.46 N 6 125122131 GC GCTCCCTC unclassified Homo probably benign phenotype 04/05/2018
46 511911 UTSW Cluh 0.565 FR4976 217.47 N 11 74669520 GCCTGA GCCTGAACCTGA small insertion Het probably benign phenotype 04/05/2018
47 511962 UTSW Cnpy3 1.000 FR4976 204.47 N 17 46736747 CCT CCTACT nonsense Het probably null phenotype 04/05/2018
48 511915 UTSW Cntnap1 0.519 FR4976 145.47 N 11 101189569 A ACCCCCC unclassified Het probably benign phenotype 04/05/2018
49 511916 UTSW Cntnap1 0.519 FR4976 217.47 N 11 101189572 CCCAGC CCCAGCACCAGC unclassified Het probably benign phenotype 04/05/2018
50 511917 UTSW Cntnap1 0.519 FR4976 217.47 N 11 101189585 CCAGCC CCAGCCTCAGCC unclassified Het probably benign phenotype 04/05/2018
51 511918 UTSW Cntnap1 0.519 FR4976 217.47 N 11 101189588 GCCCCA GCCCCACCCCCA unclassified Het probably benign phenotype 04/05/2018
52 511785 UTSW Col4a3 0.000 FR4976 217.47 N 1 82718906 CGTTTTTTTTTTTTTTTT C frame shift Het probably null phenotype 04/05/2018
53 511812 UTSW Cpne1 0.614 FR4976 214.46 N 2 156072025 AGA AGAGAGA frame shift Homo probably null phenotype 04/05/2018
54 511929 UTSW Ctsm 0.052 FR4976 214.46 N 13 61537836 AGTG AGTGGGTG frame shift Homo probably null 04/05/2018
55 511844 UTSW Cttnbp2 0.264 FR4976 217.47 N 6 18367461 GCTGCT GCTGCTCCTGCT utr 3 prime Het probably benign phenotype 04/05/2018
56 511845 UTSW Cttnbp2 0.264 FR4976 217.55 N 6 18367467 GCTGCT GCTGCTTCTGCT utr 3 prime Het probably benign phenotype 04/05/2018
57 511958 UTSW Cul9 0.417 FR4976 203.47 N 17 46500848 CTTC CTTCTTC small insertion Het probably benign phenotype 04/05/2018
58 511959 UTSW Cul9 0.417 FR4976 203.47 N 17 46500850 TCC TCCGCC small insertion Het probably benign phenotype 04/05/2018
59 511960 UTSW Cul9 0.417 FR4976 217.47 N 17 46500853 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
60 511961 UTSW Cul9 0.417 FR4976 217.47 N 17 46500856 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
61 511795 UTSW Cybrd1 0.000 FR4976 214.46 N 2 71138511 GAAT G small deletion Homo probably benign phenotype 04/05/2018
62 511892 UTSW Dbr1 0.909 FR4976 217.47 N 9 99583689 AGGAGG AGGAGGCGGAGG unclassified Het probably benign phenotype 04/05/2018
63 511893 UTSW Dbr1 0.909 FR4976 217.47 N 9 99583692 AGGAGG AGGAGGCGGAGG unclassified Het probably benign phenotype 04/05/2018
64 511894 UTSW Dbr1 0.909 FR4976 217.47 N 9 99583701 AGG AGGAGGCGG unclassified Het probably benign phenotype 04/05/2018
65 511895 UTSW Dbr1 0.909 FR4976 217.47 N 9 99583702 GG GGAGGAAG unclassified Het probably benign phenotype 04/05/2018
66 511789 UTSW Dcaf8 0.568 FR4976 222 N 1 172172856 H194Y C T missense Homo probably damaging 0.999 phenotype 04/05/2018
67 511816 UTSW Dnajc19 1.000 FR4976 111.47 N 3 34057994 AC ACGC frame shift Het probably null phenotype 04/05/2018
68 511840 UTSW Dthd1 0.254 FR4976 214.46 N 5 62843024 GAC GACTAC small insertion Homo probably benign phenotype 04/05/2018
69 511791 UTSW Dusp10 0.366 FR4976 222 N 1 184037056 C73F G T missense Homo probably damaging 0.996 0.268 phenotype 04/05/2018
70 511985 UTSW Eif3a 0.973 FR4976 214.46 N 19 60775291 A ATTTTT critical splice donor site Homo probably benign 04/05/2018
71 511793 UTSW Ermn 0.124 FR4976 200.47 N 2 58048080 CTT CTTGTT unclassified Het probably benign 04/05/2018
72 511794 UTSW Ermn 0.124 FR4976 188.47 N 2 58048088 TC TCTAC unclassified Het probably benign 04/05/2018
73 511986 UTSW Fam45a 0.040 FR4976 214.46 N 19 60814618 ACTC ACTCCTC small insertion Homo probably benign 04/05/2018
74 511987 UTSW Fam45a 0.040 FR4976 211.46 N 19 60814622 T TTCA small insertion Homo probably benign 04/05/2018
75 511978 UTSW Fbxo38 0.555 FR4976 108.47 N 18 62515347 TGCAGC TGC small deletion Het probably benign 04/05/2018
76 511879 UTSW Frem3 0.097 FR4976 214.46 N 8 80615241 CT CTTGT small insertion Homo probably benign phenotype 04/05/2018
77 511796 UTSW Fsip2 0.271 FR4976 217.47 N 2 82984362 TTTTT TTTTTGTTTT critical splice acceptor site Het probably benign phenotype 04/05/2018
78 511797 UTSW Fsip2 0.271 FR4976 217.47 N 2 82984365 TT TTTTTCT critical splice acceptor site Het probably benign phenotype 04/05/2018
79 511992 UTSW Gabre FR4976 214.46 N X 72270418 AGGCT AGGCTGCGGCT small insertion Homo probably benign 04/05/2018
80 511993 UTSW Gabre FR4976 214.47 N X 72270422 T TGAGGCC small insertion Homo probably benign 04/05/2018
81 511798 UTSW Gm10800 0.377 FR4976 214.46 N 2 98667033 A AC frame shift Homo probably null 04/05/2018
82 511815 UTSW Gm14393 0.129 FR4976 106.01 N 2 175061820 N98T T G missense Het probably benign 0.000 04/05/2018
83 511835 UTSW Gm16503 0.278 FR4976 136.01 N 4 147541253 G68E G A missense Het unknown 04/05/2018
84 511787 UTSW Gm28040 0.125 FR4976 214.46 N 1 133327323 TG TGGCACCTTTCGAG small insertion Homo probably benign 04/05/2018
85 511901 UTSW Gm4340 FR4976 195.47 N 10 104196079 AGC AGCCGC small insertion Het probably benign 04/05/2018
86 511843 UTSW Gm6309 0.069 FR4976 121.01 N 5 146168183 V307I C T missense Het probably benign 0.000 04/05/2018
87 511833 UTSW Gm7534 0.090 FR4976 214.46 N 4 134202630 TG TGCCG small insertion Homo probably benign 04/05/2018
88 511921 UTSW Golga5 0.347 FR4976 86.97 N 12 102475660 G A intron Homo probably null phenotype 04/05/2018
89 511966 UTSW Gpatch11 0.214 FR4976 217.47 N 17 78842170 GAAGAG GAAGAGCAAGAG small insertion Het probably benign 04/05/2018
90 511967 UTSW Gpatch11 0.214 FR4976 217.47 N 17 78842171 AAGAGG AAGAGGCAGAGG small insertion Het probably benign 04/05/2018
91 511968 UTSW Gpatch11 0.214 FR4976 217.47 N 17 78842172 AGAGGA AGAGGATGAGGA small insertion Het probably benign 04/05/2018
92 511969 UTSW Gpatch11 0.214 FR4976 217.47 N 17 78842173 GAGGAA GAGGAATAGGAA nonsense Het probably null 04/05/2018
93 511970 UTSW Gpatch11 0.214 FR4976 217.47 N 17 78842180 AGGAA AGGAAGTGGAA small insertion Het probably benign 04/05/2018
94 511954 UTSW H2-K1 0.118 FR4976 174.46 N 17 33997042 GTTT G unclassified Homo probably benign phenotype 04/05/2018
95 511935 UTSW Hcn1 0.080 FR4976 114.46 N 13 117975808 GCAGC GCAGCGACAGC small insertion Homo probably benign phenotype 04/05/2018
96 511847 UTSW Hoxa10 0.000 FR4976 222 N 6 52234186 Q250L T A missense Homo possibly damaging 0.595 phenotype 04/05/2018
97 511866 UTSW Igf1r 1.000 FR4976 217.47 N 7 68226181 TGGAGC TGGAGCTGGAGAGGGAGC small insertion Het probably benign phenotype 04/05/2018
98 511867 UTSW Igf1r 1.000 FR4976 217.47 N 7 68226186 C CTGGAGATGGAGA small insertion Het probably benign phenotype 04/05/2018
99 511937 UTSW Il17rd 0.000 FR4976 201.49 N 14 27082677 CGG CGGTGG utr 5 prime Het probably benign phenotype 04/05/2018
100 511817 UTSW Il2 FR4976 217.47 N 3 37125829 GG GGGGCTTGAAGTAG unclassified Het probably benign phenotype 04/05/2018
[records 1 to 100 of 223] next >> last >|