Incidental Mutations

37 incidental mutations are currently displayed, and affect 37 genes.
2 are Possibly Damaging.
12 are Probably Damaging.
15 are Probably Benign.
7 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 37 of 37] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 453264 UTSW 2310003L06Rik 0.065 IGL02984 G1 149 Y 5 87972803 I473N T A missense Het probably damaging 0.969 0.024 02/01/2017
2 453291 UTSW 4933416I08Rik 0.508 IGL02984 G1 217 Y X 53690895 TCC TCCC unclassified Het noncoding transcript 02/01/2017
3 453287 UTSW A530064D06Rik 0.000 IGL02984 G1 149 Y 17 48163280 I178V T C missense Het probably benign 0.062 0.121 02/01/2017
4 453284 UTSW Acvr1b 1.000 IGL02984 G1 212 Y 15 101203078 R374G A G missense Het probably damaging 0.980 0.246 phenotype 02/01/2017
5 453279 UTSW Aldh1l2 0.293 IGL02984 G1 120 Y 10 83527335 P55S G A missense Het probably damaging 1.000 0.486 phenotype 02/01/2017
6 453260 UTSW Bglap3 0.061 IGL02984 G1 225 Y 3 88368791 T85A T C missense Het possibly damaging 0.664 0.133 02/01/2017
7 453276 UTSW Cilp 0.050 IGL02984 G1 214 Y 9 65280130 TGGG TGG frame shift Het probably null phenotype 02/01/2017
8 453254 UTSW Crb1 0.250 IGL02984 G1 214 N 1 139237086 CG C frame shift Het probably null phenotype 02/01/2017
9 453258 UTSW Csrnp3 0.270 IGL02984 G1 120 Y 2 66022209 D315G A G missense Het probably benign 0.372 0.040 phenotype 02/01/2017
10 453277 UTSW Dclk3 0.366 IGL02984 G1 171 Y 9 111488575 Y760H T C missense Het probably damaging 1.000 0.126 phenotype 02/01/2017
11 453271 UTSW Eef1akmt2 0.209 IGL02984 G1 48 Y 7 132837206 *52R A G makesense Het probably null 0.642 02/01/2017
12 453256 UTSW Epc2 0.620 IGL02984 G1 58 Y 2 49528854 K225E A G missense Het probably damaging 0.995 0.388 02/01/2017
13 453255 UTSW Fcna 0.000 IGL02984 G1 137 Y 2 25630681 G C unclassified Het probably benign phenotype 02/01/2017
14 453272 UTSW Foxi2 0.132 IGL02984 G1 109 Y 7 135410398 T5M C T missense Het possibly damaging 0.956 0.066 phenotype 02/01/2017
15 453267 UTSW Frmd4b 0.280 IGL02984 G1 99 Y 6 97296260 T670S T A missense Het probably damaging 0.957 0.214 phenotype 02/01/2017
16 453259 UTSW Gm14137 1.000 IGL02984 G1 205 Y 2 119175480 E173D G T missense Het probably damaging 0.980 0.298 phenotype 02/01/2017
17 453261 UTSW Kif12 0.302 IGL02984 G1 113 Y 4 63171423 GGGGC GGGGCCTCCACCCGGCGGGC small insertion Het probably benign phenotype 02/01/2017
18 406666 APN Mfsd4b3 0.131 IGL02984 G1 10 39947188 G A utr 3 prime Het probably benign 08/02/2016
19 453286 UTSW Mlst8 1.000 IGL02984 G1 225 Y 17 24476153 F252S A G missense Het probably damaging 0.981 0.194 phenotype 02/01/2017
20 453275 UTSW Mmp1a 0.018 IGL02984 G1 214 Y 9 7465083 TG TGG makesense Het probably null phenotype 02/01/2017
21 453266 UTSW Mogs 0.333 IGL02984 G1 225 Y 6 83117315 K371R A G missense Het probably benign 0.005 0.172 phenotype 02/01/2017
22 453281 UTSW Nsun2 0.416 IGL02984 G1 155 Y 13 69543608 T C intron Het probably benign phenotype 02/01/2017
23 453269 UTSW Otog 0.571 IGL02984 G1 225 Y 7 46305508 C2702S T A missense Het probably damaging 0.975 0.394 phenotype 02/01/2017
24 453274 UTSW Plekhg4 0.348 IGL02984 G1 149 Y 8 105380388 E905G A G missense Het probably damaging 1.000 0.308 phenotype 02/01/2017
25 453280 UTSW Rtn4rl1 0.210 IGL02984 G1 225 Y 11 75265261 V173A T C missense Het probably benign 0.105 0.226 phenotype 02/01/2017
26 453288 UTSW Sall3 1.000 IGL02984 G1 225 Y 18 80973450 E421G T C missense Het probably benign 0.010 0.168 phenotype 02/01/2017
27 453273 UTSW Setd6 0.511 IGL02984 G1 68 Y 8 95716275 G A splice site 5 bp Het probably null 0.632 phenotype 02/01/2017
28 453263 UTSW Sh3tc1 0.150 IGL02984 G1 41 Y 5 35714059 T C splice site 4 bp Het probably null 0.639 02/01/2017
29 453253 UTSW Slc35f5 0.188 IGL02984 G1 225 Y 1 125562513 Y71N T A missense Het probably benign 0.281 0.112 02/01/2017
30 406667 APN Snx1 0.000 IGL02984 G1 9 66089108 A G splice site Het probably benign phenotype 08/02/2016
31 453262 UTSW Speer4c 0.098 IGL02984 G1 122 Y 5 15714216 A C utr 5 prime Het probably benign 0.063 02/01/2017
32 453265 UTSW Sspo 0.197 IGL02984 G1 140 Y 6 48495155 V792A T C missense Het probably benign 0.326 0.256 02/01/2017
33 453289 UTSW Sufu 1.000 IGL02984 G1 191 Y 19 46473599 D350E C A missense Het probably benign 0.000 0.202 phenotype 02/01/2017
34 453282 UTSW Trav18 0.036 IGL02984 G1 69 Y 14 53831569 Q23K C A missense Het probably damaging 1.000 0.035 02/01/2017
35 453252 UTSW Ugt1a1 0.506 IGL02984 G1 107 Y 1 88212371 AT A frame shift Het probably null phenotype 02/01/2017
36 453270 UTSW Usp17le 0.136 IGL02984 G1 165 Y 7 104769104 H277L T A missense Het probably benign 0.210 0.292 02/01/2017
37 453257 UTSW Wdsub1 0.117 IGL02984 G1 149 Y 2 59876829 S20P A G missense Het probably damaging 1.000 0.272 02/01/2017
[records 1 to 37 of 37]