Incidental Mutations

114 incidental mutations are currently displayed, and affect 112 genes.
2 are Possibly Damaging.
7 are Probably Damaging.
90 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 114] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 478174 UTSW 1700007G11Rik 0.154 LCD18 G1 999 Y 5 98707508 G A intron Het probably benign 05/26/2017
2 478031 UTSW 4930548H24Rik 0.106 LCD18 G1 999 Y 5 31487373 GAGAAG GAG small deletion Het probably benign 05/17/2017
3 484581 UTSW 9530077C05Rik 0.176 LCD18 G1 2735.94 Y 9 22442083 N intron Het probably benign 0.052 08/15/2017
4 478194 UTSW A330008L17Rik 0.114 LCD18 G1 999 Y 8 99723425 A G intron Het noncoding transcript 05/26/2017
5 478219 UTSW Aaed1 0.148 LCD18 G1 119 Y 13 64287285 G A unclassified Het probably benign 05/26/2017
6 478243 UTSW Aff2 0.116 LCD18 G1 999 Y X 69747535 C A intron Het probably benign phenotype 05/26/2017
7 478240 UTSW Aldh1a1 0.438 LCD18 G1 999 Y 19 20626646 C A intron Het probably benign phenotype 05/26/2017
8 478060 UTSW Anxa7 0.095 LCD18 G1 999 Y 14 20469411 G113E C T missense Het probably damaging 0.967 0.040 phenotype 05/17/2017
9 478187 UTSW Apba2 0.429 LCD18 G1 999 Y 7 64622160 A T intron Het probably benign 0.132 phenotype 05/26/2017
10 478203 UTSW Apc2 0.470 LCD18 G1 999 Y 10 80299974 G C intron Het probably benign 0.055 phenotype 05/26/2017
11 478231 UTSW App 0.519 LCD18 G1 999 Y 16 85025412 C G splice site Het probably benign phenotype 05/26/2017
12 478206 UTSW Asic2 0.000 LCD18 G1 999 Y 11 80985744 C A intron Het probably benign phenotype 05/26/2017
13 478246 UTSW Btk 0.433 LCD18 G1 999 Y X 134578825 T C intron Het probably benign phenotype 05/26/2017
14 478032 UTSW C530008M17Rik 0.196 LCD18 G1 133 Y 5 76658742 GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG intron Het probably benign 05/17/2017
15 478199 UTSW Car12 0.000 LCD18 G1 999 Y 9 66761676 C A intron Het probably benign phenotype 05/26/2017
16 478228 UTSW Ccdc191 0.149 LCD18 G1 999 Y 16 43921801 G A intron Het probably benign 05/26/2017
17 478287 UTSW Ccdc34 0.099 LCD18 G1 1485.22 Y 2 110016318 N unclassified Het probably benign 06/09/2017
18 478053 UTSW Cd164 0.146 LCD18 G1 999 Y 10 41521926 A59S G T missense Het probably benign 0.003 0.153 phenotype 05/17/2017
19 478038 UTSW Cd22 0.000 LCD18 G1 999 Y 7 30878082 R2H C T missense Het possibly damaging 0.948 0.074 phenotype 05/17/2017
20 478049 UTSW Cdv3 0.102 LCD18 G1 121 N 9 103365343 A T unclassified Het probably benign 05/17/2017
21 478050 UTSW Cdv3 0.102 LCD18 G1 124 N 9 103365354 C A unclassified Het probably benign 05/17/2017
22 478285 UTSW Celf2 0.338 LCD18 G1 3478.55 Y 2 6779076 N intron Het probably benign phenotype 06/09/2017
23 478195 UTSW Clec18a 0.126 LCD18 G1 999 Y 8 111076136 C A splice site Het probably benign 05/26/2017
24 523297 UTSW Cnpy3 1.000 LCD18 G1 46.7 Y 17 46737536 GGATGGAT GGATAGATAGATAGATAGATGGAT intron Het probably benign phenotype 06/21/2018
25 478183 UTSW Cntn4 0.551 LCD18 G1 999 Y 6 106553940 A G intron Het probably benign phenotype 05/26/2017
26 478235 UTSW Cntnap5c 0.119 LCD18 G1 999 Y 17 58162160 G C intron Het probably benign 05/26/2017
27 478065 UTSW Col2a1 1.000 LCD18 G1 999 N 15 97988981 C A synonymous Het probably null 0.639 phenotype 05/17/2017
28 478163 UTSW Cpne3 0.277 LCD18 G1 999 Y 4 19563382 G T intron Het probably benign phenotype 05/26/2017
29 478164 UTSW Dab1 0.705 LCD18 G1 999 Y 4 104046572 T G intron Het probably benign phenotype 05/26/2017
30 478161 UTSW Dapp1 0.376 LCD18 G1 999 Y 3 137939400 G A intron Het probably benign phenotype 05/26/2017
31 478239 UTSW Dcc 1.000 LCD18 G1 999 Y 18 72297447 G A intron Het probably benign phenotype 05/26/2017
32 478025 UTSW Dcun1d1 0.059 LCD18 G1 999 Y 3 35938005 GAAAAAAAAA GAAAAAAAAAA unclassified Het probably benign 05/17/2017
33 478150 UTSW Dennd1b 0.146 LCD18 G1 999 Y 1 139114764 G A intron Het probably benign 0.058 phenotype 05/26/2017
34 478029 UTSW Dhdds 0.940 LCD18 G1 999 Y 4 133970363 TAA TA utr 3 prime Het probably benign phenotype 05/17/2017
35 478061 UTSW Dnah12 0.587 LCD18 G1 999 Y 14 26849385 G2817V G T missense Het probably damaging 1.000 0.039 05/17/2017
36 478021 UTSW Dnm3 0.000 LCD18 G1 104 Y 1 162406561 CATATATATATATATATATATATA CATATATATATATATATATATA intron Het probably benign phenotype 05/17/2017
37 478283 UTSW Dock10 0.351 LCD18 G1 779.4 Y 1 80716623 N intron Het probably benign phenotype 06/09/2017
38 478023 UTSW Dusp10 0.366 LCD18 G1 999 Y 1 184037056 C73F G T missense Het probably damaging 0.996 0.268 phenotype 05/17/2017
39 478191 UTSW Fgf20 0.000 LCD18 G1 999 Y 8 40292318 A C intron Het probably benign phenotype 05/26/2017
40 478208 UTSW Ftsj3 0.932 LCD18 G1 999 Y 11 106250059 G T splice site Het probably benign phenotype 05/26/2017
41 478146 UTSW Gls 1.000 LCD18 G1 999 Y 1 52183367 T G intron Het probably benign phenotype 05/26/2017
42 478205 UTSW Gm12130 0.410 LCD18 G1 999 Y 11 38506923 T C intron Het noncoding transcript 05/26/2017
43 478028 UTSW Gm12394 LCD18 G1 80.7 N 4 42792885 T416A T C missense Het probably benign 0.065 05/17/2017
44 478245 UTSW Gm14936 0.201 LCD18 G1 999 Y X 112998750 G A intron Het noncoding transcript 05/26/2017
45 478180 UTSW Gm16630 0.238 LCD18 G1 999 Y 6 48141269 C T intron Het noncoding transcript 05/26/2017
46 478052 UTSW Gm22194 0.139 LCD18 G1 999 Y 10 11940963 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG exon Het noncoding transcript 05/17/2017
47 478067 UTSW Gm26917 0.201 LCD18 G1 999 Y 17 39843971 C G unclassified Het noncoding transcript 05/17/2017
48 478148 UTSW Gm35048 0.128 LCD18 G1 77.1 Y 1 90521526 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC exon Het noncoding transcript 05/26/2017
49 478230 UTSW Gm37311 0.102 LCD18 G1 999 Y 16 77618281 G A intron Het noncoding transcript 0.057 05/26/2017
50 478027 UTSW Gm37928 0.065 LCD18 G1 999 Y 3 118534557 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA unclassified Het noncoding transcript 05/17/2017
51 478068 UTSW Gm42418 0.147 LCD18 G1 999 Y 17 39848555 T C exon Het noncoding transcript 05/17/2017
52 478204 UTSW Gm4302 0.497 LCD18 G1 57.7 Y 10 100341444 W197R T C missense Het probably benign 0.196 0.157 05/26/2017
53 478197 UTSW Gm5615 0.132 LCD18 G1 999 Y 9 36533553 T C utr 3 prime Het probably benign 0.093 05/26/2017
54 478066 UTSW H2-Q4 0.021 LCD18 G1 999 Y 17 35380405 D155N G A missense Het probably damaging 1.000 0.032 phenotype 05/17/2017
55 478234 UTSW H2-T23 0.339 LCD18 G1 78.4 Y 17 36031216 T C intron Het probably benign phenotype 05/26/2017
56 478209 UTSW Hgs 0.179 LCD18 G1 999 Y 11 120469578 CTTTTTTT CTTTTTT splice site Het probably benign phenotype 05/26/2017
57 478059 UTSW Ighv5-9 0.116 LCD18 G1 999 Y 12 113661877 S82N C T missense Het probably benign 0.017 0.100 05/17/2017
58 478227 UTSW Il1rap 0.000 LCD18 G1 999 Y 16 26631593 C A intron Het probably benign phenotype 05/26/2017
59 499809 UTSW Inhbc 0.000 LCD18 G1 606.46 Y 10 127367140 N intron Het probably benign phenotype 11/21/2017
60 478193 UTSW Inpp4b 0.393 LCD18 G1 999 Y 8 81693010 C T intron Het probably benign phenotype 05/26/2017
61 484580 UTSW Kars 0.945 LCD18 G1 549.59 Y 8 111993708 N critical splice acceptor site Het probably benign phenotype 08/15/2017
62 478044 UTSW Kcng4 0.020 LCD18 G1 999 Y 8 119633519 Y39* G T nonsense Het probably null 0.660 phenotype 05/17/2017
63 478155 UTSW Kcnh7 0.241 LCD18 G1 999 Y 2 63049799 A G intron Het probably benign phenotype 05/26/2017
64 478224 UTSW Klhl1 0.155 LCD18 G1 999 Y 14 96317730 G C intron Het probably benign phenotype 05/26/2017
65 478223 UTSW Lrch1 0.207 LCD18 G1 999 Y 14 74905021 C T intron Het probably benign phenotype 05/26/2017
66 478154 UTSW Lrp1b 0.000 LCD18 G1 999 Y 2 42237562 G C intron Het probably benign phenotype 05/26/2017
67 478178 UTSW Lsm8 0.938 LCD18 G1 28.9 Y 6 18844316 G A unclassified Het probably benign phenotype 05/26/2017
68 478179 UTSW Lsm8 0.938 LCD18 G1 999 Y 6 18854321 G A unclassified Het probably benign phenotype 05/26/2017
69 478172 UTSW Magi2 1.000 LCD18 G1 999 Y 5 19954511 T C intron Het probably benign phenotype 05/26/2017
70 478152 UTSW Marc2 0.078 LCD18 G1 999 Y 1 184822788 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA intron Het probably benign 0.101 phenotype 05/26/2017
71 478220 UTSW Mef2c 1.000 LCD18 G1 999 Y 13 83605823 G A intron Het probably benign phenotype 05/26/2017
72 478200 UTSW Mei4 0.152 LCD18 G1 999 Y 9 82186959 A G intron Het probably benign phenotype 05/26/2017
73 478248 UTSW Mid1 0.000 LCD18 G1 30.7 Y X 170005564 T A unclassified Het probably benign phenotype 05/26/2017
74 478022 UTSW Mndal 0.185 LCD18 G1 88.6 Y 1 173880218 G C unclassified Het probably benign 05/17/2017
75 478156 UTSW Mpped2 0.492 LCD18 G1 999 Y 2 106721428 C A intron Het probably benign phenotype 05/26/2017
76 478165 UTSW Mtf1 1.000 LCD18 G1 999 Y 4 124829316 A G intron Het probably benign 0.121 phenotype 05/26/2017
77 478182 UTSW Mxd1 0.411 LCD18 G1 999 Y 6 86667406 T C intron Het probably benign phenotype 05/26/2017
78 478159 UTSW Nbea 1.000 LCD18 G1 999 Y 3 55701527 G T intron Het probably benign 0.060 phenotype 05/26/2017
79 484582 UTSW Ncor1 1.000 LCD18 G1 151.81 Y 11 62419782 N critical splice acceptor site Het probably benign phenotype 08/15/2017
80 478188 UTSW Nox4 0.518 LCD18 G1 999 Y 7 87243067 A G unclassified Het probably benign phenotype 05/26/2017
81 478221 UTSW Ocln 0.424 LCD18 G1 999 Y 13 100520567 C T intron Het probably benign phenotype 05/26/2017
82 478217 UTSW Ofcc1 0.000 LCD18 G1 999 Y 13 40092967 G A intron Het probably benign phenotype 05/26/2017
83 478055 UTSW Olfr313 0.065 LCD18 G1 179 Y 11 58817440 V144D T A missense Het possibly damaging 0.797 0.182 phenotype 05/17/2017
84 484578 UTSW Paics 0.501 LCD18 G1 558.1 Y 5 76956744 N frame shift Het probably null 0.448 phenotype 08/15/2017
85 478145 UTSW Paqr8 0.583 LCD18 G1 999 Y 1 20914658 G T intron Het probably benign 05/26/2017
86 478153 UTSW Pdss1 0.876 LCD18 G1 999 Y 2 22900968 C T intron Het probably benign phenotype 05/26/2017
87 478045 UTSW Piezo1 1.000 LCD18 G1 999 Y 8 122495569 R503W G A missense Het probably damaging 1.000 0.400 phenotype 05/17/2017
88 478144 UTSW Pkhd1 0.301 LCD18 G1 999 Y 1 20611414 G A intron Het probably benign phenotype 05/26/2017
89 478070 UTSW Ppp1r3f 0.014 LCD18 G1 999 Y X 7560336 G562V C A missense Het probably damaging 1.000 0.247 phenotype 05/17/2017
90 478238 UTSW Prr16 0.097 LCD18 G1 999 Y 18 51200324 C T intron Het probably benign 05/26/2017
91 478056 UTSW Prss38 0.177 LCD18 G1 999 Y 11 59375641 T G utr 5 prime Het probably benign 05/17/2017
92 478201 UTSW Ptprk 0.494 LCD18 G1 999 Y 10 28574987 T C intron Het probably benign phenotype 05/26/2017
93 484577 UTSW Pum1 0.000 LCD18 G1 280.17 Y 4 130730549 N intron Het probably benign phenotype 08/15/2017
94 484579 UTSW Rabgef1 0.335 LCD18 G1 748.39 Y 5 130187586 N frame shift Het probably null 0.622 phenotype 08/15/2017
95 478151 UTSW Rgs16 0.073 LCD18 G1 999 Y 1 153744230 G A utr 3 prime Het probably benign phenotype 05/26/2017
96 478236 UTSW Riok3 0.357 LCD18 G1 999 Y 18 12129982 G T intron Het probably benign 0.124 phenotype 05/26/2017
97 484583 UTSW Robo2 0.873 LCD18 G1 247.84 Y 16 74055954 N intron Het probably benign phenotype 08/15/2017
98 478247 UTSW Rps6ka3 0.000 LCD18 G1 999 Y X 159279215 A G splice site Het probably benign phenotype 05/26/2017
99 478026 UTSW Rptn 0.057 LCD18 G1 116 Y 3 93397541 L727Q T A missense Het probably benign 0.000 0.121 05/17/2017
100 478237 UTSW Slc25a46 0.173 LCD18 G1 999 Y 18 31597313 C A intron Het probably benign phenotype 05/26/2017
[records 1 to 100 of 114] next >> last >|