Incidental Mutations

68 incidental mutations are currently displayed, and affect 68 genes.
9 are Possibly Damaging.
25 are Probably Damaging.
24 are Probably Benign.
8 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 68 of 68] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 33280 UTSW 2410089E03Rik 1.000 R0105 G1 225 Y 15 8187392 V698D T A missense Het probably benign 0.000 0.143 phenotype 05/09/2013
2 33258 UTSW 5530400C23Rik 0.147 R0105 G1 225 Y 6 133294314 R107K G A missense Het probably benign 0.317 0.162 05/09/2013
3 33254 UTSW A530053G22Rik 0.074 R0105 G1 225 Y 6 60402152 T C intron Het noncoding transcript 0.124 05/09/2013
4 33285 UTSW Adcy9 0.602 R0105 G1 225 Y 16 4288388 V954A A G missense Het probably damaging 1.000 0.150 phenotype 05/09/2013
5 33272 UTSW Aldh8a1 0.071 R0105 G1 225 Y 10 21395539 M388K T A missense Het probably damaging 0.994 0.154 phenotype 05/09/2013
6 33291 UTSW Ankhd1 0.000 R0105 G1 225 Y 18 36646766 I1720M A G missense Het probably damaging 1.000 0.178 05/09/2013
7 33253 UTSW Atp6v0a4 1.000 R0105 G1 212 Y 6 38053129 T C splice site Het probably benign 0.067 phenotype 05/09/2013
8 33240 UTSW C1qtnf4 0.092 R0105 G1 131 Y 2 90890363 *327R T A makesense Het probably null 0.550 05/09/2013
9 33257 UTSW C1s1 0.111 R0105 G1 199 Y 6 124541318 T C splice site Het probably benign 05/09/2013
10 33287 UTSW Cdsn 1.000 R0105 G1 180 Y 17 35556138 R521S A C missense Het possibly damaging 0.663 0.055 phenotype 05/09/2013
11 33270 UTSW Cgnl1 0.000 R0105 G1 128 Y 9 71656102 M848V T C missense Het probably benign 0.000 0.112 phenotype 05/09/2013
12 33279 UTSW Cog3 1.000 R0105 G1 225 Y 14 75722140 S591P A G missense Het probably damaging 0.994 0.360 phenotype 05/09/2013
13 33231 UTSW Col6a3 0.000 R0105 G1 225 Y 1 90798161 V1375A A G missense Het possibly damaging 0.655 0.008 phenotype 05/09/2013
14 33234 UTSW Cr1l 1.000 R0105 G1 205 Y 1 195112412 A G splice site Het probably benign phenotype 05/09/2013
15 33251 UTSW Crmp1 0.431 R0105 G1 211 Y 5 37284135 D520E T A missense Het probably damaging 0.998 0.292 phenotype 05/09/2013
16 33242 UTSW Ctdspl2 0.959 R0105 G1 122 Y 2 121977320 T A splice site Het probably benign 05/09/2013
17 17420 UTSW Ddhd1 0.000 R0105 G1 Y 14 45610690 D507G T C missense Het probably benign 0.374 0.066 phenotype 01/31/2013
18 33255 UTSW Dnah6 0.141 R0105 G1 225 Y 6 73155279 A1147T C T missense Het probably damaging 0.988 0.210 phenotype 05/09/2013
19 33290 UTSW Dsg2 0.256 R0105 G1 225 Y 18 20602054 S1030P T C missense Het probably benign 0.027 0.068 phenotype 05/09/2013
20 33269 UTSW Elavl3 0.454 R0105 G1 225 Y 9 22036833 V12F C A missense Het possibly damaging 0.839 0.116 phenotype 05/09/2013
21 33233 UTSW Fam20b 1.000 R0105 G1 225 Y 1 156690570 E218G T C missense Het probably damaging 1.000 0.654 phenotype 05/09/2013
22 33283 UTSW Fam227a 0.052 R0105 G1 225 Y 15 79620832 D466G T C missense Het possibly damaging 0.904 0.138 05/09/2013
23 33267 UTSW Fto 0.000 R0105 G1 225 Y 8 91522802 E421K G A missense Het probably damaging 0.999 0.276 phenotype 05/09/2013
24 33263 UTSW Gab2 0.401 R0105 G1 225 Y 7 97299072 Y290H T C missense Het probably damaging 1.000 0.076 phenotype 05/09/2013
25 33229 UTSW Gm973 0.075 R0105 G1 225 Y 1 59582474 Q591R A G missense Het probably null 0.603 0.272 05/09/2013
26 33282 UTSW Gsdmc2 0.066 R0105 G1 225 Y 15 63828177 T249A T C missense Het probably benign 0.000 0.110 05/09/2013
27 33235 UTSW Il15ra 0.056 R0105 G1 225 Y 2 11730648 T A critical splice donor site 2 bp Het probably null 0.526 phenotype 05/09/2013
28 66323 UTSW Il1rl1 0.000 R0105 G1 217 Y 1 40442574 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG splice site Het probably benign 0.132 phenotype 08/19/2013
29 33244 UTSW Il6ra 0.000 R0105 G1 225 Y 3 89876818 I382T A G missense Het probably damaging 0.998 0.082 phenotype 05/09/2013
30 33256 UTSW Isy1 0.186 R0105 G1 209 Y 6 87819185 R257W G A missense Het probably damaging 0.997 0.028 phenotype 05/09/2013
31 33284 UTSW Krt76 0.000 R0105 G1 225 Y 15 101884912 T564A T C missense Het unknown 0.090 phenotype 05/09/2013
32 33264 UTSW Lhpp 0.260 R0105 G1 165 Y 7 132630525 S57P T C missense Het probably damaging 0.993 0.140 05/09/2013
33 33262 UTSW Lrrk1 1.000 R0105 G1 225 Y 7 66292341 D716E G T missense Het probably damaging 1.000 0.168 phenotype 05/09/2013
34 33274 UTSW Mcm3ap 1.000 R0105 G1 225 Y 10 76499534 D1263E T A missense Het probably damaging 1.000 0.029 phenotype 05/09/2013
35 33230 UTSW Mogat1 0.062 R0105 G1 225 Y 1 78523670 T124A A G missense Het probably benign 0.166 0.116 phenotype 05/09/2013
36 33246 UTSW Mroh7 0.000 R0105 G1 225 Y 4 106711270 T48A T C missense Het possibly damaging 0.488 0.107 05/09/2013
37 33260 UTSW Nccrp1 0.072 R0105 G1 225 Y 7 28547038 D33G T C missense Het probably benign 0.215 0.172 05/09/2013
38 33278 UTSW Neurog1 1.000 R0105 G1 225 Y 13 56251237 D232E G T missense Het probably benign 0.342 0.102 phenotype 05/09/2013
39 33238 UTSW Olfr1202 0.060 R0105 G1 218 Y 2 88817909 V246D T A missense Het probably damaging 0.997 0.069 phenotype 05/09/2013
40 33239 UTSW Olfr1243 0.076 R0105 G1 225 Y 2 89528363 T16A T C missense Het probably benign 0.005 0.118 phenotype 05/09/2013
41 33261 UTSW Otog 0.657 R0105 G1 225 Y 7 46288366 T1833K C A missense Het possibly damaging 0.787 0.228 phenotype 05/09/2013
42 33249 UTSW Perm1 0.081 R0105 G1 225 Y 4 156218225 H409N C A missense Het probably benign 0.228 0.112 05/09/2013
43 33276 UTSW Pik3r5 0.137 R0105 G1 173 Y 11 68490511 E174D A T missense Het probably damaging 0.994 0.027 phenotype 05/09/2013
44 33228 UTSW Pkhd1 0.105 R0105 G1 225 Y 1 20523732 Q1386* G A nonsense Het probably null 0.626 phenotype 05/09/2013
45 33237 UTSW Pla2r1 0.000 R0105 G1 201 Y 2 60514981 R344G T C missense Het possibly damaging 0.893 0.146 phenotype 05/09/2013
46 33259 UTSW Plekha5 0.251 R0105 G1 225 Y 6 140591747 R646K G A missense Het possibly damaging 0.799 0.016 05/09/2013
47 33268 UTSW Plekhg4 0.173 R0105 G1 225 Y 8 105382012 V1202M G A missense Het possibly damaging 0.651 0.030 phenotype 05/09/2013
48 33271 UTSW Ppil4 0.908 R0105 G1 220 Y 10 7798446 Y118C A G missense Het probably damaging 1.000 0.290 phenotype 05/09/2013
49 33236 UTSW Prrc2b 1.000 R0105 G1 225 Y 2 32213311 E934* G T nonsense Het probably null 0.548 05/09/2013
50 33286 UTSW Psmb9 0.180 R0105 G1 163 Y 17 34187275 F12S A G missense Het probably benign 0.000 0.128 phenotype 05/09/2013
51 33265 UTSW Ptdss2 0.107 R0105 G1 225 Y 7 141152880 W183R T C missense Het probably damaging 1.000 0.516 phenotype 05/09/2013
52 33232 UTSW Ptpn4 0.296 R0105 G1 225 Y 1 119687605 C T splice site 5 bp Het probably null 0.606 phenotype 05/09/2013
53 33250 UTSW Reln 0.947 R0105 G1 225 Y 5 22048815 R600W G A missense Het probably damaging 0.987 0.031 phenotype 05/09/2013
54 33273 UTSW Scml4 0.152 R0105 G1 191 Y 10 42930599 V161E T A missense Het probably damaging 1.000 0.264 05/09/2013
55 33243 UTSW Sdcbp2 0.293 R0105 G1 225 Y 2 151589558 T284S A T missense Het probably benign 0.000 0.004 phenotype 05/09/2013
56 33293 UTSW Slc22a29 0.000 R0105 G1 161 Y 19 8160627 T C unclassified Het probably benign 0.088 05/09/2013
57 33266 UTSW Slc35e1 0.141 R0105 G1 113 Y 8 72492571 T C unclassified Het probably benign 0.053 05/09/2013
58 33248 UTSW Spen 1.000 R0105 G1 143 Y 4 141469810 T C splice site Het probably benign phenotype 05/09/2013
59 33252 UTSW Sumf2 0.102 R0105 G1 117 Y 5 129849894 T A splice site Het probably benign phenotype 05/09/2013
60 33292 UTSW Tbx10 0.178 R0105 G1 156 Y 19 3993121 A G unclassified Het probably benign 0.110 phenotype 05/09/2013
61 33245 UTSW Tex10 0.954 R0105 G1 225 Y 4 48468957 V73F C A missense Het probably damaging 0.992 0.376 phenotype 05/09/2013
62 33241 UTSW Tgm5 0.158 R0105 G1 225 Y 2 121077012 G77W C A missense Het probably damaging 1.000 0.238 phenotype 05/09/2013
63 33288 UTSW Tnfrsf21 0.123 R0105 G1 225 Y 17 43040191 T A critical splice donor site 2 bp Het probably null 0.498 phenotype 05/09/2013
64 33289 UTSW Treml2 0.057 R0105 G1 225 Y 17 48302828 T96I C T missense Het probably damaging 0.985 0.166 phenotype 05/09/2013
65 33277 UTSW Trim65 0.000 R0105 G1 99 Y 11 116126066 *523W T C makesense Het probably null 0.558 05/09/2013
66 33247 UTSW Zcchc17 0.153 R0105 G1 219 Y 4 130349306 D28V T A missense Het probably benign 0.360 0.202 phenotype 05/09/2013
67 33281 UTSW Zhx2 0.382 R0105 G1 225 Y 15 57822695 F487L T C missense Het probably damaging 1.000 0.390 phenotype 05/09/2013
68 33275 UTSW Zkscan6 0.145 R0105 G1 225 Y 11 65821985 L248Q T A missense Het probably damaging 1.000 0.170 05/09/2013
[records 1 to 68 of 68]