Incidental Mutations

77 incidental mutations are currently displayed, and affect 77 genes.
12 are Possibly Damaging.
29 are Probably Damaging.
22 are Probably Benign.
10 are Probably Null.
2 create premature stop codons.
7 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 500098 UTSW 2010315B03Rik 0.124 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
2 65771 UTSW 4732465J04Rik 0.256 R0164 G1 161 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC frame shift Het probably null 08/19/2013
3 60664 UTSW 4930522L14Rik 0.155 R0164 G1 144 Y 5 109736847 K382E T C missense Het probably damaging 0.962 0.063 07/24/2013
4 24366 UTSW Adck1 0.197 R0164 G1 225 N 12 88455510 E297G A G missense Het probably damaging 0.988 0.378 04/16/2013
5 24356 UTSW Aldh3a2 0.098 R0164 G1 225 N 11 61248888 V473I C T missense Het probably benign 0.226 0.104 phenotype 04/16/2013
6 24352 UTSW Arfgef3 0.258 R0164 G1 210 N 10 18647915 I369K A T missense Het possibly damaging 0.772 0.178 phenotype 04/16/2013
7 60674 UTSW Atl2 0.887 R0164 G1 118 Y 17 79853831 A G unclassified Het probably benign 07/24/2013
8 24350 UTSW Atp1b3 0.453 R0164 G1 225 N 9 96338709 I178V T C missense Het possibly damaging 0.874 0.140 phenotype 04/16/2013
9 24309 UTSW Axdnd1 0.142 R0164 G1 171 N 1 156378386 E520G T C missense Het possibly damaging 0.933 0.114 phenotype 04/16/2013
10 24353 UTSW BB019430 0.152 R0164 G1 225 N 10 58704271 A T exon Het noncoding transcript 0.064 04/16/2013
11 24339 UTSW Btbd1 0.641 R0164 G1 225 N 7 81801003 Q343L T A missense Het probably benign 0.277 0.252 phenotype 04/16/2013
12 24391 UTSW Catsper1 0.171 R0164 G1 220 N 19 5339475 T473A A G missense Het possibly damaging 0.933 0.204 phenotype 04/16/2013
13 24362 UTSW Chmp6 0.878 R0164 G1 211 N 11 119915523 G A critical splice donor site 1 bp Het probably null 0.654 phenotype 04/16/2013
14 60668 UTSW D130040H23Rik 0.234 R0164 G1 89 N 8 69302543 V200A T C missense Het possibly damaging 0.606 07/24/2013
15 24364 UTSW D830013O20Rik 0.263 R0164 G1 225 N 12 73364331 C T unclassified Het noncoding transcript 0.043 04/16/2013
16 64966 UTSW Dcaf1 1.000 R0164 G1 225 N 9 106844145 S379T T A missense Het possibly damaging 0.935 0.070 phenotype 08/08/2013
17 60669 UTSW Dcaf4 0.083 R0164 G1 225 Y 12 83535988 G A splice site Het probably benign 0.066 phenotype 07/24/2013
18 24360 UTSW Dhx58 0.168 R0164 G1 225 N 11 100695324 I624V T C missense Het probably benign 0.421 0.050 phenotype 04/16/2013
19 24321 UTSW Disp3 0.140 R0164 G1 202 N 4 148254251 E821G T C missense Het probably damaging 0.963 0.144 04/16/2013
20 24341 UTSW Dlc1 1.000 R0164 G1 225 N 8 36599440 E464V T A missense Het probably damaging 0.965 0.272 phenotype 04/16/2013
21 24330 UTSW Dnah10 0.439 R0164 G1 225 N 5 124783834 V2151I G A missense Het probably damaging 0.998 0.028 phenotype 04/16/2013
22 24386 UTSW Dnah8 0.448 R0164 G1 225 N 17 30748665 G2617D G A missense Het probably benign 0.000 0.116 phenotype 04/16/2013
23 24357 UTSW Dnah9 0.657 R0164 G1 225 N 11 65918804 E872* C A nonsense Het probably null 0.670 phenotype 04/16/2013
24 24371 UTSW Dock9 0.340 R0164 G1 212 N 14 121597665 Y99C T C missense Het probably damaging 1.000 0.222 04/16/2013
25 24337 UTSW Dpy19l3 0.188 R0164 G1 225 N 7 35716646 I310F T A missense Het probably damaging 0.979 0.396 04/16/2013
26 24316 UTSW Fggy 0.245 R0164 G1 225 N 4 95837654 I137F A T missense Het probably damaging 0.968 0.170 phenotype 04/16/2013
27 24313 UTSW Gm14012 R0164 G1 225 Y 2 128238016 C T splice site Het noncoding transcript 04/16/2013
28 500095 UTSW Gm14421 R0164 G1 134 N 2 177056722 A T critical splice donor site Het noncoding transcript 12/01/2017
29 24390 UTSW Gm5689 0.103 R0164 G1 225 N 18 42173543 D58E T A missense Het probably damaging 0.994 0.024 04/16/2013
30 500109 UTSW Grin2a 0.454 R0164 G1 225 N 16 9994821 A G critical splice donor site 2 bp Het probably null phenotype 12/01/2017
31 24392 UTSW Incenp 1.000 R0164 G1 225 N 19 9894879 S72P A G missense Het probably benign 0.226 0.198 phenotype 04/16/2013
32 60672 UTSW Ipo11 0.968 R0164 G1 108 Y 13 106910194 A G splice site Het probably benign phenotype 07/24/2013
33 24336 UTSW Klc3 0.225 R0164 G1 225 N 7 19394926 N469Y T A missense Het possibly damaging 0.676 0.298 phenotype 04/16/2013
34 24317 UTSW Lrrc42 0.225 R0164 G1 225 N 4 107247505 S88P A G missense Het probably benign 0.006 0.108 04/16/2013
35 24348 UTSW Lrrc49 0.231 R0164 G1 225 N 9 60680600 T93I G A missense Het probably benign 0.264 0.116 04/16/2013
36 60673 UTSW Ltn1 1.000 R0164 G1 214 Y 16 87405519 G A splice site Het probably benign 0.120 phenotype 07/24/2013
37 24345 UTSW Mlycd 0.251 R0164 G1 225 N 8 119407641 Q294L A T missense Het probably damaging 0.999 0.334 phenotype 04/16/2013
38 24355 UTSW Mrpl22 0.936 R0164 G1 225 N 11 58171821 I19N T A missense Het probably benign 0.000 0.130 phenotype 04/16/2013
39 24369 UTSW Msh3 0.414 R0164 G1 225 N 13 92349209 K202N T A missense Het probably damaging 1.000 0.126 phenotype 04/16/2013
40 24378 UTSW Mucl2 0.046 R0164 G1 186 N 15 103899179 C T splice site 5 bp Het probably null 04/16/2013
41 60663 UTSW N4bp2 0.165 R0164 G1 143 Y 5 65803573 T C splice site Het probably benign 0.155 phenotype 07/24/2013
42 24346 UTSW Ncam1 0.868 R0164 G1 225 N 9 49568409 D90N C T missense Het probably damaging 0.995 0.058 phenotype 04/16/2013
43 24308 UTSW Nckap5 0.000 R0164 G1 225 N 1 126024407 D1405E A T missense Het possibly damaging 0.837 0.067 04/16/2013
44 24306 UTSW Ncoa2 0.970 R0164 G1 225 N 1 13186731 A G critical splice donor site 2 bp Het probably null 0.584 phenotype 04/16/2013
45 65770 UTSW Ncoa6 1.000 R0164 G1 217 Y 2 155408291 TGC TGCGC frame shift Het probably null 0.645 phenotype 08/19/2013
46 24358 UTSW Nlrp1b 0.063 R0164 G1 225 N 11 71164099 W844R A T missense Het probably damaging 1.000 0.478 phenotype 04/16/2013
47 24323 UTSW Nmnat1 1.000 R0164 G1 225 N 4 149469150 N168K G T missense Het possibly damaging 0.782 0.060 phenotype 04/16/2013
48 24393 UTSW Olfr1446 0.070 R0164 G1 225 N 19 12890445 L44P A G missense Het probably damaging 1.000 0.364 phenotype 04/16/2013
49 24324 UTSW Ost4 R0164 G1 225 N 5 30907459 H26R T C missense Het probably damaging 0.999 0.256 04/16/2013
50 60667 UTSW Otog 0.571 R0164 G1 225 Y 7 46304231 V2638M G A missense Het probably damaging 0.973 0.128 phenotype 07/24/2013
51 24354 UTSW Otogl 0.405 R0164 G1 225 N 10 107874530 I566N A T missense Het probably damaging 0.968 0.288 phenotype 04/16/2013
52 24380 UTSW Pcyt1a 1.000 R0164 G1 225 N 16 32470186 S282P T C missense Het probably damaging 0.999 0.530 phenotype 04/16/2013
53 24335 UTSW Prkcg 0.000 R0164 G1 225 N 7 3329119 E581K G A missense Het probably damaging 1.000 0.252 phenotype 04/16/2013
54 24310 UTSW Ralgps2 0.439 R0164 G1 225 N 1 156887089 A G critical splice donor site 2 bp Het probably null 0.576 04/16/2013
55 24319 UTSW Scmh1 0.000 R0164 G1 225 N 4 120529865 T C unclassified Het probably benign 0.067 phenotype 04/16/2013
56 500097 UTSW Sgo2b 0.180 R0164 G1 225 N 8 63938383 H150R T C missense Het possibly damaging 0.915 0.058 12/01/2017
57 60665 UTSW Sh2b3 0.445 R0164 G1 117 Y 5 121829037 T5P T G missense Het probably damaging 0.966 0.024 phenotype 07/24/2013
58 24367 UTSW Tdp2 0.599 R0164 G1 225 N 13 24838239 M214V A G missense Het probably damaging 1.000 0.292 phenotype 04/16/2013
59 261790 UTSW Tmem144 0.134 R0164 G1 225 Y 3 79839273 G A start gained Het probably benign 0.098 02/04/2015
60 24385 UTSW Tmem204 0.115 R0164 G1 225 N 17 25058350 I187T A G missense Het probably damaging 0.992 0.028 phenotype 04/16/2013
61 24344 UTSW Tmem208 0.191 R0164 G1 225 N 8 105334694 D117E T G missense Het probably benign 0.014 0.160 phenotype 04/16/2013
62 24312 UTSW Tnks1bp1 0.292 R0164 G1 225 N 2 85059221 P631S C T missense Het possibly damaging 0.937 0.136 04/16/2013
63 24381 UTSW Tomm70a 0.973 R0164 G1 215 N 16 57147821 V517A T C missense Het probably damaging 0.964 0.272 phenotype 04/16/2013
64 60675 UTSW Ttc7 0.745 R0164 G1 129 Y 17 87379895 V801A T C missense Het probably damaging 0.996 0.330 phenotype 07/24/2013
65 60670 UTSW Txndc5 0.366 R0164 G1 131 Y 13 38507953 C146S A T missense Het probably damaging 1.000 0.464 phenotype 07/24/2013
66 24322 UTSW Ube4b 1.000 R0164 G1 225 N 4 149360324 T493K G T missense Het probably damaging 0.978 0.081 phenotype 04/16/2013
67 24315 UTSW Ufl1 0.840 R0164 G1 225 N 4 25256008 Y504N A T missense Het probably benign 0.001 0.078 phenotype 04/16/2013
68 65769 UTSW Ugt1a6a 0.044 R0164 G1 225 Y 1 88139270 V266A T C missense Het possibly damaging 0.634 0.048 08/19/2013
69 65768 UTSW Ugt1a6b 0.101 R0164 G1 186 Y 1 88107467 C176S T A missense Het probably damaging 0.985 0.262 08/19/2013
70 24347 UTSW Ulk3 0.110 R0164 G1 225 N 9 57590686 I90N T A missense Het probably damaging 1.000 0.316 04/16/2013
71 24349 UTSW Unc13c 0.339 R0164 G1 225 N 9 73694892 I1357M T C missense Het probably benign 0.008 0.132 phenotype 04/16/2013
72 64965 UTSW Vmn1r28 0.091 R0164 G1 225 N 6 58265717 A182T G A missense Het probably benign 0.001 0.118 08/08/2013
73 65772 UTSW Vmn2r114 0.124 R0164 G1 225 Y 17 23309826 A G critical splice donor site 2 bp Het probably null 0.660 08/19/2013
74 24384 UTSW Vmn2r91 0.126 R0164 G1 225 N 17 18106137 N228T A C missense Het probably benign 0.004 0.117 04/16/2013
75 24373 UTSW Wisp1 0.123 R0164 G1 225 N 15 66919210 L287P T C missense Het probably damaging 1.000 0.062 phenotype 04/16/2013
76 24311 UTSW Zbtb6 0.231 R0164 G1 225 N 2 37429588 Y109* G T nonsense Het probably null 0.682 04/16/2013
77 500096 UTSW Zfp980 0.241 R0164 G1 87 N 4 145701997 D432G A G missense Het probably benign 0.000 12/01/2017
[records 1 to 77 of 77]