Incidental Mutations

93 incidental mutations are currently displayed, and affect 92 genes.
19 are Possibly Damaging.
33 are Probably Damaging.
28 are Probably Benign.
13 are Probably Null.
7 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 93 of 93] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 66069 UTSW Aar2 0.296 R0238 G1 225 N 2 156550973 V94G T G missense Het probably benign 0.000 0.136 phenotype 08/19/2013
2 66111 UTSW Acp5 0.355 R0238 G1 225 N 9 22129922 S70T A T missense Het possibly damaging 0.900 0.256 phenotype 08/19/2013
3 66126 UTSW Adcy1 0.000 R0238 G1 121 N 11 7139162 N525K C G missense Het possibly damaging 0.795 0.066 phenotype 08/19/2013
4 59094 UTSW Adra1d 0.046 R0238 G1 216 Y 2 131546214 V474F C A missense Het probably benign 0.007 0.040 phenotype 07/11/2013
5 66077 UTSW AI464131 0.246 R0238 G1 203 N 4 41498912 N239K A T missense Het probably benign 0.113 0.098 08/19/2013
6 66073 UTSW Aknad1 0.038 R0238 G1 225 N 3 108781239 M628V A G missense Het probably benign 0.000 phenotype 08/19/2013
7 66098 UTSW Alg8 0.782 R0238 G1 147 N 7 97383684 A T critical splice acceptor site Het probably null 0.554 phenotype 08/19/2013
8 66140 UTSW Cacna1d 0.674 R0238 G1 225 N 14 30123496 V572A A G missense Het probably benign 0.295 0.092 phenotype 08/19/2013
9 66086 UTSW Ccdc158 0.203 R0238 G1 225 N 5 92662118 M177R A C missense Het probably benign 0.306 0.032 08/19/2013
10 66146 UTSW Ccdc191 0.167 R0238 G1 188 N 16 43947496 R678* A T nonsense Het probably null 0.598 08/19/2013
11 98967 UTSW Cdkn2d 0.251 R0238 G1 191 Y 9 21290992 C A start gained Het probably benign phenotype 01/10/2014
12 66087 UTSW Cdx2 1.000 R0238 G1 225 N 5 147303287 T193K G T missense Het probably damaging 1.000 0.326 phenotype 08/19/2013
13 66147 UTSW Cfap44 0.153 R0238 G1 225 N 16 44422318 M695K T A missense Het probably benign 0.000 0.130 phenotype 08/19/2013
14 66139 UTSW Cfap70 0.135 R0238 G1 225 N 14 20448605 S5A A C missense Het probably benign 0.006 0.128 08/19/2013
15 66106 UTSW Chd9 0.527 R0238 G1 225 N 8 90932828 S139P T C missense Het probably damaging 0.999 0.122 08/19/2013
16 66142 UTSW Chmp7 0.385 R0238 G1 158 N 14 69720997 V241A A G missense Het probably damaging 0.982 0.300 08/19/2013
17 66085 UTSW Cnga1 0.271 R0238 G1 225 N 5 72605031 I380T A G missense Het probably damaging 0.967 0.308 phenotype 08/19/2013
18 66137 UTSW Cts6 0.044 R0238 G1 222 N 13 61201819 E53D T A missense Het probably damaging 1.000 0.027 08/19/2013
19 66118 UTSW Dclk3 0.350 R0238 G1 170 N 9 111482628 N646I A T missense Het probably damaging 0.994 0.066 phenotype 08/19/2013
20 66100 UTSW Dnhd1 0.139 R0238 G1 200 N 7 105721531 S4673G A G missense Het probably benign 0.057 0.162 08/19/2013
21 66131 UTSW Dock4 0.257 R0238 G1 225 N 12 40737540 S818I G T missense Het probably damaging 0.978 0.256 phenotype 08/19/2013
22 66089 UTSW Dysf 0.000 R0238 G1 138 N 6 84064479 Q156* C T nonsense Het probably null 0.662 phenotype 08/19/2013
23 59085 UTSW Espnl 0.131 R0238 G1 179 Y 1 91322287 V52A T C missense Het probably damaging 0.969 0.146 07/11/2013
24 66065 UTSW Fam163b 0.106 R0238 G1 167 N 2 27112634 N117S T C missense Het probably damaging 0.999 0.232 08/19/2013
25 66109 UTSW Fam89a 0.039 R0238 G1 225 N 8 124741232 Y114H A G missense Het probably damaging 1.000 0.216 08/19/2013
26 66127 UTSW Flcn 1.000 R0238 G1 175 N 11 59801076 N249S T C missense Het probably benign 0.001 0.078 phenotype 08/19/2013
27 66105 UTSW Gm20422 R0238 G1 225 N 8 69766715 Y53C T C missense Het probably damaging 0.999 0.026 08/19/2013
28 66081 UTSW Gnai1 0.000 R0238 G1 126 N 5 18273550 S206P A G missense Het probably damaging 1.000 phenotype 08/19/2013
29 66122 UTSW Hal 0.126 R0238 G1 225 N 10 93503482 S478P T C missense Het possibly damaging 0.613 0.128 phenotype 08/19/2013
30 66084 UTSW Haus3 1.000 R0238 G1 138 N 5 34166256 P337S G A missense Het possibly damaging 0.537 0.142 phenotype 08/19/2013
31 66132 UTSW Hectd1 1.000 R0238 G1 225 N 12 51769318 M1324L T A missense Het possibly damaging 0.720 0.184 phenotype 08/19/2013
32 66136 UTSW Hist1h1t 0.000 R0238 G1 204 N 13 23696324 K153N G T missense Het possibly damaging 0.921 0.094 phenotype 08/19/2013
33 66151 UTSW Hspa9 0.956 R0238 G1 221 N 18 34946646 Y243* A T nonsense Het probably null 0.638 phenotype 08/19/2013
34 66113 UTSW Htr3a 0.000 R0238 G1 129 N 9 48906386 T96A T C missense Het probably benign 0.058 0.070 phenotype 08/19/2013
35 66149 UTSW Ift140 1.000 R0238 G1 190 N 17 25045523 C557* C A nonsense Het probably null 0.637 phenotype 08/19/2013
36 66108 UTSW Jph3 0.188 R0238 G1 216 N 8 121753720 Q379R A G missense Het possibly damaging 0.830 0.118 phenotype 08/19/2013
37 66071 UTSW Kcnb1 0.000 R0238 G1 160 N 2 167104969 V653A A G missense Het probably benign 0.041 0.118 phenotype 08/19/2013
38 66062 UTSW Kif14 0.779 R0238 G1 225 N 1 136527393 E1551G A G missense Het probably damaging 0.988 0.108 phenotype 08/19/2013
39 66130 UTSW Krt17 0.117 R0238 G1 214 N 11 100260878 R30* G A nonsense Het probably null 0.623 phenotype 08/19/2013
40 66063 UTSW Lamb3 0.398 R0238 G1 143 N 1 193321053 D100V A T missense Het probably damaging 1.000 0.210 phenotype 08/19/2013
41 66059 UTSW Map2 0.539 R0238 G1 225 N 1 66416106 D1385G A G missense Het probably damaging 1.000 0.318 phenotype 08/19/2013
42 66110 UTSW Map3k21 0.394 R0238 G1 225 N 8 125944970 D999G A G missense Het possibly damaging 0.674 0.088 08/19/2013
43 66145 UTSW Marf1 0.192 R0238 G1 225 N 16 14151283 I109V T C missense Het probably benign 0.001 0.111 phenotype 08/19/2013
44 66112 UTSW Mcam 0.377 R0238 G1 225 N 9 44140205 T G unclassified 3136 bp Het probably null 0.522 phenotype 08/19/2013
45 66079 UTSW Med18 0.890 R0238 G1 225 N 4 132460026 H99R T C missense Het probably damaging 0.961 0.178 phenotype 08/19/2013
46 66123 UTSW Mettl25 0.151 R0238 G1 225 N 10 105826525 V195I C T missense Het probably damaging 0.995 0.398 08/19/2013
47 59170 UTSW Micu2 0.174 R0238 G1 139 Y 14 57917378 G A splice site Het probably benign phenotype 07/11/2013
48 66128 UTSW Myh8 0.835 R0238 G1 225 N 11 67301692 T1466A A G missense Het probably benign 0.001 0.038 phenotype 08/19/2013
49 66115 UTSW Myo1e 0.000 R0238 G1 148 N 9 70342126 I503F A T missense Het possibly damaging 0.864 0.262 phenotype 08/19/2013
50 66066 UTSW Myo3b 0.739 R0238 G1 225 N 2 70105425 C61S T A missense Het probably benign 0.005 0.044 phenotype 08/19/2013
51 59114 UTSW Ndufa4 0.416 R0238 G1 225 Y 6 11906024 V10I C T missense Het probably benign 0.140 0.122 phenotype 07/11/2013
52 66129 UTSW Nf1 1.000 R0238 G1 225 N 11 79418574 K438M A T missense Het possibly damaging 0.886 0.200 phenotype 08/19/2013
53 66095 UTSW Nlrp9c 0.000 R0238 G1 225 N 7 26378012 S727P A G missense Het possibly damaging 0.904 0.059 08/19/2013
54 66120 UTSW Nmbr 0.093 R0238 G1 225 N 10 14770395 Q338* C T nonsense Het probably null 0.566 phenotype 08/19/2013
55 66116 UTSW Nt5e 0.000 R0238 G1 177 N 9 88367332 S440G A G missense Het possibly damaging 0.810 0.220 phenotype 08/19/2013
56 66148 UTSW Nubp2 0.901 R0238 G1 191 N 17 24884471 E144G T C missense Het probably damaging 1.000 0.576 phenotype 08/19/2013
57 66067 UTSW Olfr1126 0.099 R0238 G1 225 N 2 87458037 F291L T C missense Het probably benign 0.001 0.133 phenotype 08/19/2013
58 66099 UTSW Olfr593 0.046 R0238 G1 225 N 7 103212726 V289M G A missense Het possibly damaging 0.928 0.105 phenotype 08/19/2013
59 66101 UTSW Olfr694 0.073 R0238 G1 225 N 7 106689255 Y159H A G missense Het probably benign 0.001 0.274 phenotype 08/19/2013
60 66124 UTSW Otogl 0.421 R0238 G1 225 N 10 107806696 N1291I T A missense Het probably damaging 0.983 0.092 phenotype 08/19/2013
61 66125 UTSW Pa2g4 0.469 R0238 G1 159 N 10 128563642 K51R T C missense Het probably benign 0.000 0.148 phenotype 08/19/2013
62 59149 UTSW Pah 0.393 R0238 G1 225 Y 10 87567281 P173S C T missense Het possibly damaging 0.737 0.358 phenotype 07/11/2013
63 66152 UTSW Pcdhb12 0.064 R0238 G1 225 N 18 37436727 I309V A G missense Het probably benign 0.005 0.250 08/19/2013
64 66072 UTSW Pck1 1.000 R0238 G1 216 N 2 173157068 I373S T G missense Het possibly damaging 0.906 0.306 phenotype 08/19/2013
65 66155 UTSW Pga5 0.055 R0238 G1 225 N 19 10669453 Y305H A G missense Het probably damaging 0.999 0.027 08/19/2013
66 66091 UTSW Plxnd1 1.000 R0238 G1 225 N 6 115968793 D906E G T missense Het probably benign 0.001 0.074 phenotype 08/19/2013
67 66060 UTSW Ppfia4 0.111 R0238 G1 225 N 1 134329189 E98G T C missense Het possibly damaging 0.892 0.336 08/19/2013
68 66114 UTSW Rab39 0.129 R0238 G1 190 N 9 53706030 T29I G A missense Het probably damaging 0.976 0.248 08/19/2013
69 66121 UTSW Raet1e 0.373 R0238 G1 225 N 10 22180862 H112Q C A missense Het possibly damaging 0.649 0.072 08/19/2013
70 66075 UTSW Rars2 0.881 R0238 G1 225 N 4 34645838 Y252H T C missense Het probably damaging 1.000 0.466 phenotype 08/19/2013
71 66076 UTSW Rars2 0.881 R0238 G1 211 N 4 34656030 Q421P A C missense Het probably benign 0.001 0.040 phenotype 08/19/2013
72 66117 UTSW Rasa2 0.240 R0238 G1 180 N 9 96568407 D479E A T missense Het probably damaging 1.000 0.230 phenotype 08/19/2013
73 66107 UTSW Rbl2 1.000 R0238 G1 204 N 8 91106507 T689S A T missense Het probably damaging 0.992 0.244 phenotype 08/19/2013
74 66070 UTSW Rims4 0.069 R0238 G1 201 N 2 163864025 V230M C T missense Het probably benign 0.030 0.092 phenotype 08/19/2013
75 59179 UTSW Six3 1.000 R0238 G1 126 Y 17 85621390 G51R G A missense Het probably damaging 0.996 0.068 phenotype 07/11/2013
76 66143 UTSW Skp2 0.000 R0238 G1 127 N 15 9127884 A C critical splice donor site 2 bp Het probably null 0.632 phenotype 08/19/2013
77 66141 UTSW Slc35f4 0.333 R0238 G1 184 N 14 49304256 I347N A T missense Het possibly damaging 0.780 0.138 08/19/2013
78 66082 UTSW Slc4a2 0.547 R0238 G1 225 N 5 24436274 A T splice site 3 bp Het probably null 0.661 phenotype 08/19/2013
79 66068 UTSW Slc52a3 0.156 R0238 G1 192 N 2 152008156 *461Q T C makesense Het probably null 0.522 phenotype 08/19/2013
80 66090 UTSW Slc6a1 0.177 R0238 G1 225 N 6 114302800 V142I G A missense Het probably benign 0.131 0.070 phenotype 08/19/2013
81 66119 UTSW Susd5 0.169 R0238 G1 160 N 9 114096909 *620W A G makesense Het probably null 0.478 08/19/2013
82 66153 UTSW Timm21 0.000 R0238 G1 225 N 18 84947666 N239S T C missense Het probably damaging 0.999 0.328 phenotype 08/19/2013
83 66133 UTSW Tmem63c 0.181 R0238 G1 140 N 12 87075639 W404R T C missense Het probably damaging 1.000 0.360 08/19/2013
84 66144 UTSW Tnrc6b 0.409 R0238 G1 138 N 15 80887864 D1118G A G missense Het probably damaging 0.998 0.172 phenotype 08/19/2013
85 66064 UTSW Traf2 0.709 R0238 G1 139 N 2 25537126 A71G G C missense Het possibly damaging 0.897 0.300 phenotype 08/19/2013
86 66083 UTSW Trim54 0.000 R0238 G1 216 N 5 31134119 M195V A G missense Het probably benign 0.182 0.062 phenotype 08/19/2013
87 66134 UTSW Trip11 1.000 R0238 G1 221 N 12 101884728 E741K C T missense Het probably damaging 1.000 0.322 phenotype 08/19/2013
88 501782 UTSW Trp73 0.618 R0238 G1 129 N 4 154062524 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG unclassified Het probably benign phenotype 12/01/2017
89 66103 UTSW Trpm5 0.159 R0238 G1 218 N 7 143082958 T414N G T missense Het probably damaging 0.998 0.032 phenotype 08/19/2013
90 66154 UTSW Vps51 0.927 R0238 G1 225 N 19 6071437 S185* G T nonsense Het probably null 0.608 phenotype 08/19/2013
91 66094 UTSW Zfp329 0.208 R0238 G1 141 N 7 12810829 T256K G T missense Het probably damaging 1.000 0.216 08/19/2013
92 66138 UTSW Zfp729b 0.108 R0238 G1 225 N 13 67591903 Y748H A G missense Het probably damaging 0.978 0.032 08/19/2013
93 66088 UTSW Zfp777 0.411 R0238 G1 225 N 6 48024969 E773G T C missense Het probably damaging 0.989 0.198 08/19/2013
[records 1 to 93 of 93]