Incidental Mutations

88 incidental mutations are currently displayed, and affect 87 genes.
13 are Possibly Damaging.
26 are Probably Damaging.
35 are Probably Benign.
10 are Probably Null.
4 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 88 of 88] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 35067 UTSW 4930432E11Rik 0.163 R0268 G1 178 Y 7 29574602 T A unclassified Het noncoding transcript 05/09/2013
2 35071 UTSW 5430419D17Rik 0.038 R0268 G1 218 Y 7 131238176 D609G A G missense Het probably damaging 1.000 0.025 05/09/2013
3 35054 UTSW Aadacl4 0.089 R0268 G1 225 Y 4 144622995 H274L A T missense Het probably benign 0.001 0.140 05/09/2013
4 35119 UTSW Aldh1a7 0.263 R0268 G1 225 Y 19 20709502 T A critical splice acceptor site Het probably null 0.586 05/09/2013
5 35096 UTSW Ap3m1 0.127 R0268 G1 145 Y 14 21037102 A C splice site Het probably benign phenotype 05/09/2013
6 35117 UTSW Atp5a1 1.000 R0268 G1 176 Y 18 77780195 N356K C A missense Het probably damaging 0.965 0.216 phenotype 05/09/2013
7 35101 UTSW AU021092 0.100 R0268 G1 205 Y 16 5222167 M31K A T missense Het possibly damaging 0.707 0.061 phenotype 05/09/2013
8 35085 UTSW Avpr1a 0.140 R0268 G1 162 Y 10 122449709 V302A T C missense Het probably damaging 1.000 0.156 phenotype 05/09/2013
9 35111 UTSW Bicral 1.000 R0268 G1 89 Y 17 46814052 A G splice site Het probably benign phenotype 05/09/2013
10 35109 UTSW Btbd9 0.413 R0268 G1 225 Y 17 30274942 D492N C T missense Het possibly damaging 0.922 0.342 phenotype 05/09/2013
11 35051 UTSW Casp8ap2 1.000 R0268 G1 225 Y 4 32644079 I1051F A T missense Het probably damaging 0.993 0.244 phenotype 05/09/2013
12 35073 UTSW Cd209e 0.016 R0268 G1 207 Y 8 3849125 I196V T C missense Het probably benign 0.335 0.236 phenotype 05/09/2013
13 35039 UTSW Cdc42bpa 0.493 R0268 G1 152 Y 1 180155782 G T intron Het probably benign phenotype 05/09/2013
14 35102 UTSW Clec16a 0.489 R0268 G1 213 Y 16 10644828 L670* T A nonsense Het probably null 0.520 phenotype 05/09/2013
15 35075 UTSW Cmtm2b 0.017 R0268 G1 173 Y 8 104322434 E27G A G missense Het probably damaging 1.000 0.188 phenotype 05/09/2013
16 35074 UTSW Col4a1 1.000 R0268 G1 109 Y 8 11267588 T A splice site Het probably benign phenotype 05/09/2013
17 35064 UTSW Cyp26b1 1.000 R0268 G1 146 Y 6 84574572 F221I A T missense Het probably damaging 1.000 0.272 phenotype 05/09/2013
18 35045 UTSW D430041D05Rik 0.119 R0268 G1 171 Y 2 104167950 P1836R G C missense Het probably damaging 1.000 0.344 05/09/2013
19 216127 UTSW Dennd6b 0.128 R0268 G1 21 Y 15 89196229 Q56R T C missense Het probably benign 0.013 0.464 07/25/2014
20 35095 UTSW Dip2c 0.831 R0268 G1 141 Y 13 9637150 R1270H G A missense Het probably damaging 1.000 0.027 phenotype 05/09/2013
21 35103 UTSW Dlg1 1.000 R0268 G1 183 Y 16 31684193 C73R T C missense Het probably benign 0.000 0.130 phenotype 05/09/2013
22 35110 UTSW Dnah8 0.551 R0268 G1 156 Y 17 30769707 D3217G A G missense Het probably damaging 0.996 0.490 phenotype 05/09/2013
23 35061 UTSW Dtx1 0.000 R0268 G1 198 Y 5 120681291 E614G T C missense Het probably damaging 1.000 0.524 phenotype 05/09/2013
24 35046 UTSW Dut 0.970 R0268 G1 225 Y 2 125257091 A166E C A missense Het probably damaging 1.000 0.406 phenotype 05/09/2013
25 35087 UTSW Ebf1 0.932 R0268 G1 104 Y 11 44643413 D166E C A missense Het probably damaging 0.959 0.072 phenotype 05/09/2013
26 35066 UTSW Egln2 0.000 R0268 G1 175 Y 7 27165247 D84E A T missense Het possibly damaging 0.572 0.002 phenotype 05/09/2013
27 35080 UTSW Exosc7 0.974 R0268 G1 189 Y 9 123118960 S65T T A missense Het probably benign 0.078 0.096 05/09/2013
28 35069 UTSW Fam83e 0.026 R0268 G1 169 Y 7 45726910 R349Q G A missense Het probably benign 0.000 0.124 05/09/2013
29 35113 UTSW Fbxl17 0.275 R0268 G1 198 Y 17 63385067 G A splice site Het probably benign phenotype 05/09/2013
30 35059 UTSW Fras1 0.000 R0268 G1 213 Y 5 96737009 N2582S A G missense Het probably damaging 0.986 0.164 phenotype 05/09/2013
31 35050 UTSW Fubp1 0.953 R0268 G1 173 Y 3 152219713 V164A T C missense Het probably damaging 0.990 0.204 phenotype 05/09/2013
32 35077 UTSW Gfral 0.092 R0268 G1 178 Y 9 76197101 C210S A T missense Het probably damaging 1.000 0.516 phenotype 05/09/2013
33 66358 UTSW Gls 1.000 R0268 G1 102 N 1 52232694 GGCTGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 08/19/2013
34 35053 UTSW Gm13084 0.068 R0268 G1 151 N 4 143810768 I331N A T missense Het probably damaging 0.996 05/09/2013
35 35076 UTSW Hcn4 1.000 R0268 G1 161 Y 9 58860162 E1002A A C missense Het unknown 0.058 phenotype 05/09/2013
36 35078 UTSW Hcrtr2 0.119 R0268 G1 93 Y 9 76228188 V449A A G missense Het probably benign 0.000 0.113 phenotype 05/09/2013
37 35093 UTSW Hectd1 1.000 R0268 G1 145 Y 12 51769107 S1394I C A missense Het probably damaging 0.993 0.246 phenotype 05/09/2013
38 35094 UTSW Hectd1 1.000 R0268 G1 150 Y 12 51769108 S1394G T C missense Het possibly damaging 0.942 0.186 phenotype 05/09/2013
39 35036 UTSW Hecw2 0.449 R0268 G1 117 Y 1 53926698 A G splice site Het probably benign phenotype 05/09/2013
40 35063 UTSW Herc3 0.000 R0268 G1 105 Y 6 58868628 A G splice site Het probably benign phenotype 05/09/2013
41 35097 UTSW Ipo4 0.281 R0268 G1 200 Y 14 55625942 Q1073R T C missense Het possibly damaging 0.917 0.046 05/09/2013
42 35092 UTSW Itsn2 0.000 R0268 G1 225 Y 12 4700333 R1199Q G A missense Het probably benign 0.115 0.145 phenotype 05/09/2013
43 35041 UTSW Kcnj3 0.000 R0268 G1 225 Y 2 55594959 Y356* C A nonsense Het probably null 0.672 phenotype 05/09/2013
44 35058 UTSW Klb 0.392 R0268 G1 192 Y 5 65348837 D142E T A missense Het probably benign 0.023 0.088 phenotype 05/09/2013
45 35070 UTSW Klhl35 0.185 R0268 G1 151 Y 7 99471751 S409T T A missense Het probably benign 0.332 0.128 05/09/2013
46 35090 UTSW Krt16 0.130 R0268 G1 207 Y 11 100246525 T A splice site Het probably benign phenotype 05/09/2013
47 35100 UTSW Krt82 0.020 R0268 G1 225 Y 15 101541713 R516L C A missense Het probably benign 0.021 0.136 phenotype 05/09/2013
48 35049 UTSW Lce3a 0.294 R0268 G1 214 Y 3 92925731 C21S A T missense Het unknown 0.045 05/09/2013
49 35116 UTSW Lims2 0.000 R0268 G1 212 Y 18 31944520 E103G A G missense Het probably benign 0.156 0.028 phenotype 05/09/2013
50 35037 UTSW Map2 0.544 R0268 G1 225 Y 1 66380722 K71* A T nonsense Het probably null 0.592 phenotype 05/09/2013
51 35055 UTSW Mthfr 0.696 R0268 G1 225 Y 4 148055428 S618W C G missense Het probably damaging 0.999 0.026 phenotype 05/09/2013
52 35098 UTSW Mycbp2 1.000 R0268 G1 131 Y 14 103314325 R157* T A nonsense Het probably null 0.636 phenotype 05/09/2013
53 35044 UTSW Nat10 0.967 R0268 G1 225 Y 2 103727917 C A splice site Het probably benign phenotype 05/09/2013
54 35089 UTSW Obscn 0.731 R0268 G1 225 Y 11 59067272 T3810M G A missense Het possibly damaging 0.782 0.064 phenotype 05/09/2013
55 35043 UTSW Olfr1161 0.191 R0268 G1 225 Y 2 88025468 I249F A T missense Het probably damaging 0.991 0.138 phenotype 05/09/2013
56 35081 UTSW Olfr1354 0.213 R0268 G1 201 Y 10 78917605 T255I C T missense Het probably damaging 0.994 0.030 phenotype 05/09/2013
57 35088 UTSW Olfr1375 0.145 R0268 G1 184 Y 11 51048941 M278K T A missense Het probably damaging 0.999 phenotype 05/09/2013
58 35072 UTSW Olfr525 0.049 R0268 G1 225 Y 7 140323155 S152N G A missense Het possibly damaging 0.630 0.064 phenotype 05/09/2013
59 35086 UTSW Olfr799 0.090 R0268 G1 139 Y 10 129647176 D16V A T missense Het possibly damaging 0.945 0.070 phenotype 05/09/2013
60 35042 UTSW Olfr998 0.339 R0268 G1 187 Y 2 85591301 T254A A G missense Het possibly damaging 0.780 0.066 phenotype 05/09/2013
61 35056 UTSW Park7 0.471 R0268 G1 146 Y 4 150908349 V20A A G missense Het possibly damaging 0.943 0.330 phenotype 05/09/2013
62 35057 UTSW Pgm1 0.000 R0268 G1 126 Y 5 64105808 V266E T A missense Het probably damaging 1.000 0.370 phenotype 05/09/2013
63 35079 UTSW Phip 1.000 R0268 G1 225 Y 9 82871288 T1801I G A missense Het probably damaging 0.996 0.320 phenotype 05/09/2013
64 35099 UTSW Pkhd1l1 0.273 R0268 G1 225 Y 15 44597011 H4205Q C A missense Het probably benign 0.154 0.051 05/09/2013
65 35083 UTSW Ppp1r12a 1.000 R0268 G1 142 Y 10 108273381 T A intron Het probably benign phenotype 05/09/2013
66 35118 UTSW Ppp1r32 0.051 R0268 G1 142 N 19 10477085 V329A A G missense Het possibly damaging 0.881 05/09/2013
67 35082 UTSW Ptprq 0.459 R0268 G1 225 Y 10 107705548 D372E A T missense Het probably benign 0.000 0.036 phenotype 05/09/2013
68 35084 UTSW Ptprr 0.000 R0268 G1 190 Y 10 116252963 V340I G A missense Het possibly damaging 0.828 0.072 phenotype 05/09/2013
69 35105 UTSW Qk 1.000 R0268 G1 96 Y 17 10209646 A G splice site Het probably benign phenotype 05/09/2013
70 35115 UTSW Qpct 0.288 R0268 G1 159 Y 17 79077652 D240E T A missense Het probably benign 0.036 0.129 phenotype 05/09/2013
71 35038 UTSW Ren1 1.000 R0268 G1 156 Y 1 133355611 T162A A G missense Het possibly damaging 0.744 0.058 phenotype 05/09/2013
72 35040 UTSW Rif1 1.000 R0268 G1 107 Y 2 52090286 T C critical splice donor site 2 bp Het probably null 0.540 phenotype 05/09/2013
73 35060 UTSW Sart3 0.974 R0268 G1 204 Y 5 113752399 V461A A G missense Het probably damaging 0.989 0.424 phenotype 05/09/2013
74 35068 UTSW Scgb1b24 0.050 R0268 G1 189 Y 7 33743853 G19R G A missense Het probably null 0.999 0.617 05/09/2013
75 35052 UTSW Spen 1.000 R0268 G1 207 Y 4 141477557 I1253N A T missense Het unknown 0.064 phenotype 05/09/2013
76 35062 UTSW Sspo 0.000 R0268 G1 98 Y 6 48465555 H1995N C A missense Het probably benign 0.264 0.330 05/09/2013
77 35048 UTSW Tfap2c 1.000 R0268 G1 222 Y 2 172551503 T113A A G missense Het probably benign 0.009 0.084 phenotype 05/09/2013
78 35114 UTSW Togaram2 0.182 R0268 G1 109 Y 17 71697998 T C critical splice donor site 2 bp Het probably null 0.530 05/09/2013
79 35091 UTSW Trim65 0.083 R0268 G1 127 Y 11 116126644 T A splice site Het probably benign 05/09/2013
80 216128 UTSW Trpm3 0.179 R0268 G1 26 Y 19 22897521 T A critical splice donor site 2 bp Het probably null 0.496 phenotype 07/25/2014
81 35104 UTSW Ubxn7 0.334 R0268 G1 216 Y 16 32360046 I87T T C missense Het probably benign 0.053 0.312 05/09/2013
82 35112 UTSW Vav1 0.265 R0268 G1 223 Y 17 57296090 F81L T C missense Het probably damaging 1.000 0.344 phenotype 05/09/2013
83 35106 UTSW Vmn2r102 0.000 R0268 G1 225 Y 17 19677850 T376A A G missense Het probably benign 0.001 0.134 05/09/2013
84 35107 UTSW Vmn2r105 0.000 R0268 G1 208 Y 17 20208676 C713S A T missense Het probably benign 0.176 0.130 05/09/2013
85 35065 UTSW Zbtb45 0.145 R0268 G1 225 Y 7 13008327 M1I C T start codon destroyed Het probably null 0.595 0.388 05/09/2013
86 35108 UTSW Zfp229 0.345 R0268 G1 198 Y 17 21745841 M351L A T missense Het probably benign 0.000 0.135 05/09/2013
87 216126 UTSW Zfp932 0.119 R0268 G1 36 Y 5 110009063 I176T T C missense Het probably benign 0.236 0.126 07/25/2014
88 35047 UTSW Zswim1 0.241 R0268 G1 225 Y 2 164826126 E433K G A missense Het probably damaging 0.993 0.240 05/09/2013
[records 1 to 88 of 88]