Incidental Mutations

76 incidental mutations are currently displayed, and affect 75 genes.
7 are Possibly Damaging.
34 are Probably Damaging.
26 are Probably Benign.
7 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 30173 UTSW 4930522H14Rik 0.061 R0363 G1 225 Y 4 109524323 Q86L T A missense Het probably null 0.000 0.128 04/24/2013
2 30177 UTSW 5430403G16Rik 0.068 R0363 G1 206 Y 5 109676888 E232G T C missense Het probably benign 0.026 0.142 04/24/2013
3 65706 UTSW Abhd2 0.410 R0363 G1 147 Y 7 79350813 D262G A G missense Het possibly damaging 0.805 0.184 phenotype 08/08/2013
4 30191 UTSW Abhd5 0.000 R0363 G1 225 Y 9 122368146 F133L T C missense Het possibly damaging 0.610 0.084 phenotype 04/24/2013
5 30193 UTSW Agap2 0.272 R0363 G1 225 Y 10 127090965 V957E T A missense Het probably damaging 1.000 0.028 phenotype 04/24/2013
6 30211 UTSW Ankrd12 0.230 R0363 G1 225 Y 17 65985681 K919R T C missense Het probably damaging 1.000 0.021 phenotype 04/24/2013
7 65707 UTSW Ap1m1 1.000 R0363 G1 153 Y 8 72256724 T C unclassified Het probably benign phenotype 08/08/2013
8 30186 UTSW Ap1m1 1.000 R0363 G1 225 Y 8 72252894 S245P T C missense Het probably benign 0.225 0.252 phenotype 04/24/2013
9 30216 UTSW Apcdd1 0.179 R0363 G1 225 Y 18 62937097 Y145C A G missense Het possibly damaging 0.460 0.278 phenotype 04/24/2013
10 30198 UTSW Apob 0.926 R0363 G1 225 Y 12 8010136 N2840Y A T missense Het probably damaging 0.995 0.106 phenotype 04/24/2013
11 30200 UTSW Arel1 0.715 R0363 G1 225 Y 12 84934253 S327P A G missense Het probably damaging 0.996 0.360 04/24/2013
12 30161 UTSW Arhgap21 0.464 R0363 G1 225 Y 2 20881133 R421L C A missense Het probably damaging 0.999 0.030 phenotype 04/24/2013
13 216201 UTSW Ccdc85a 0.322 R0363 G1 31 Y 11 28583400 I48N A T missense Het probably damaging 0.998 0.202 07/30/2014
14 30169 UTSW Chd6 0.834 R0363 G1 225 Y 2 161014324 S672P A G missense Het probably damaging 0.998 0.192 phenotype 04/24/2013
15 30162 UTSW Ciz1 0.214 R0363 G1 225 Y 2 32377363 G C critical splice donor site 1 bp Het probably null 0.576 phenotype 04/24/2013
16 30204 UTSW Cmbl 0.000 R0363 G1 225 Y 15 31585442 G A splice site 5 bp Het probably null 0.610 phenotype 04/24/2013
17 30201 UTSW Cmya5 0.351 R0363 G1 225 Y 13 93094869 V1237A A G missense Het possibly damaging 0.771 0.056 04/24/2013
18 30189 UTSW Cntnap4 0.141 R0363 G1 225 Y 8 112856511 K1074* A T nonsense Het probably null 0.600 phenotype 04/24/2013
19 30159 UTSW Cntnap5b 0.153 R0363 G1 225 Y 1 100274468 M347V A G missense Het probably benign 0.006 0.012 04/24/2013
20 65704 UTSW Col1a2 0.000 R0363 G1 225 Y 6 4518822 G A unclassified Het probably benign 0.108 phenotype 08/08/2013
21 30183 UTSW Cuzd1 0.097 R0363 G1 214 Y 7 131316262 M203K A T missense Het probably benign 0.155 0.129 phenotype 04/24/2013
22 30179 UTSW Cyp3a16 0.557 R0363 G1 225 Y 5 145455879 T C splice site Het probably benign 0.104 04/24/2013
23 30174 UTSW Dlgap3 0.114 R0363 G1 225 Y 4 127235521 E892G A G missense Het probably damaging 1.000 0.348 phenotype 04/24/2013
24 30158 UTSW Dnah7b 0.314 R0363 G1 225 Y 1 46236788 S2612P T C missense Het probably damaging 0.986 0.218 04/24/2013
25 30213 UTSW Epas1 1.000 R0363 G1 225 Y 17 86805848 T G splice site Het probably benign phenotype 04/24/2013
26 30207 UTSW Etv5 0.680 R0363 G1 225 Y 16 22411708 A192V G A missense Het probably benign 0.004 0.046 phenotype 04/24/2013
27 30188 UTSW Fa2h 0.315 R0363 G1 225 Y 8 111349289 H234L T A missense Het probably damaging 0.999 0.582 phenotype 04/24/2013
28 30185 UTSW Fcho1 0.263 R0363 G1 225 Y 8 71717490 Y47C T C missense Het probably damaging 1.000 0.450 04/24/2013
29 65701 UTSW Flvcr1 1.000 R0363 G1 156 Y 1 191012254 T A splice site Het probably benign phenotype 08/08/2013
30 66481 UTSW Il1rl1 0.000 R0363 G1 217 Y 1 40442574 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG splice site Het probably benign 0.132 phenotype 08/19/2013
31 65702 UTSW Ino80 0.968 R0363 G1 130 Y 2 119382960 R1249C G A missense Het probably damaging 1.000 0.026 phenotype 08/08/2013
32 30187 UTSW Inpp4b 0.368 R0363 G1 225 Y 8 81884257 T C splice site Het probably benign phenotype 04/24/2013
33 30180 UTSW Isy1 0.216 R0363 G1 225 Y 6 87819185 R257W G A missense Het probably damaging 0.997 0.028 phenotype 04/24/2013
34 65708 UTSW Kmt2a 1.000 R0363 G1 124 Y 9 44809713 A G critical splice donor site 2 bp Het probably null 0.528 phenotype 08/08/2013
35 30205 UTSW Krt4 0.316 R0363 G1 213 Y 15 101924646 R9C G A missense Het possibly damaging 0.906 0.052 phenotype 04/24/2013
36 30165 UTSW Map1a 0.521 R0363 G1 225 Y 2 121302044 S876P T C missense Het probably damaging 1.000 0.176 phenotype 04/24/2013
37 30157 UTSW Mettl21e 0.114 R0363 G1 184 Y 1 44211030 A G critical splice donor site 2 bp Het probably null 0.632 04/24/2013
38 30214 UTSW Msh2 0.824 R0363 G1 225 Y 17 87717476 T594M C T missense Het probably benign 0.304 0.113 phenotype 04/24/2013
39 30194 UTSW Mtmr3 0.000 R0363 G1 225 Y 11 4487536 S973P A G missense Het probably damaging 0.994 0.310 phenotype 04/24/2013
40 30184 UTSW Muc5ac 0.000 R0363 G1 225 Y 7 141800960 M889L A T missense Het probably benign 0.008 0.105 phenotype 04/24/2013
41 30196 UTSW Ntn1 0.341 R0363 G1 222 Y 11 68385543 I193T A G missense Het probably benign 0.435 0.114 phenotype 04/24/2013
42 216202 UTSW Nudt13 0.000 R0363 G1 49 Y 14 20309783 I193F A T missense Het probably damaging 0.964 0.264 07/30/2014
43 30164 UTSW Olfr1272 0.093 R0363 G1 225 Y 2 90281856 S240T A T missense Het probably damaging 0.999 0.026 phenotype 04/24/2013
44 30209 UTSW Olfr134 0.149 R0363 G1 225 Y 17 38175447 D121G A G missense Het probably damaging 1.000 0.047 phenotype 04/24/2013
45 30197 UTSW Olfr410 0.132 R0363 G1 225 Y 11 74335099 G44D C T missense Het probably damaging 0.998 0.448 phenotype 04/24/2013
46 30182 UTSW Olfr498 0.078 R0363 G1 225 Y 7 108465734 T137S A T missense Het possibly damaging 0.807 0.092 phenotype 04/24/2013
47 30203 UTSW Otulin 1.000 R0363 G1 225 Y 15 27606295 V344A A G missense Het probably damaging 1.000 0.232 phenotype 04/24/2013
48 30178 UTSW P2rx7 0.000 R0363 G1 225 Y 5 122657030 Q128* C T nonsense Het probably null 0.640 phenotype 04/24/2013
49 30215 UTSW Pcdhb22 0.000 R0363 G1 225 Y 18 37519160 R227H G A missense Het probably benign 0.012 0.111 phenotype 04/24/2013
50 65705 UTSW Plekha5 0.182 R0363 G1 176 Y 6 140591747 R646K G A missense Het possibly damaging 0.799 0.016 08/08/2013
51 30170 UTSW Pltp 0.119 R0363 G1 225 Y 2 164840136 R394H C T missense Het probably benign 0.032 0.056 phenotype 04/24/2013
52 30166 UTSW Ppip5k1 0.271 R0363 G1 225 Y 2 121347355 A324P C G missense Het probably damaging 1.000 0.228 phenotype 04/24/2013
53 216200 UTSW Pramef17 0.057 R0363 G1 72 Y 4 143991651 M407I C T missense Het probably benign 0.006 0.127 07/30/2014
54 65703 UTSW Prdm13 0.000 R0363 G1 86 Y 4 21679737 V251G A C missense Het unknown 0.056 phenotype 08/08/2013
55 30218 UTSW Prkg1 0.539 R0363 G1 225 Y 19 31664196 E29G T C missense Het probably damaging 0.996 0.070 phenotype 04/24/2013
56 30160 UTSW Prrc2c 0.489 R0363 G1 225 Y 1 162697811 S409P A G missense Het unknown 0.070 04/24/2013
57 30156 UTSW Rp1 0.114 R0363 G1 225 Y 1 4347718 D1057V T A missense Het probably damaging 0.995 0.034 phenotype 04/24/2013
58 30217 UTSW Rttn 1.000 R0363 G1 225 Y 18 89010955 C599Y G A missense Het probably damaging 0.999 0.198 phenotype 04/24/2013
59 30195 UTSW Shisa6 0.000 R0363 G1 215 Y 11 66525327 R213Q C T missense Het probably benign 0.172 0.192 04/24/2013
60 30212 UTSW Slc3a1 0.000 R0363 G1 225 Y 17 85032845 Y232H T C missense Het probably damaging 1.000 0.184 phenotype 04/24/2013
61 30206 UTSW Slx4 1.000 R0363 G1 225 Y 16 3980089 A1477V G A missense Het probably damaging 0.999 0.058 phenotype 04/24/2013
62 30163 UTSW Ssrp1 1.000 R0363 G1 225 Y 2 85040674 I218S T G missense Het probably damaging 0.988 0.296 phenotype 04/24/2013
63 65709 UTSW St6galnac1 0.054 R0363 G1 101 N 11 116768930 S186A A C missense Het probably benign 0.361 phenotype 08/08/2013
64 30202 UTSW Stab1 0.000 R0363 G1 225 Y 14 31159008 A G splice site Het probably benign phenotype 04/24/2013
65 30171 UTSW Sycp2 0.000 R0363 G1 225 Y 2 178346411 T C splice site Het probably benign phenotype 04/24/2013
66 30199 UTSW Syne2 0.507 R0363 G1 225 Y 12 76072207 I5867N T A missense Het probably damaging 0.980 0.024 phenotype 04/24/2013
67 30192 UTSW Taar7f 0.150 R0363 G1 225 Y 10 24049941 D144E T A missense Het probably damaging 0.999 0.358 04/24/2013
68 30190 UTSW Tmem136 0.000 R0363 G1 225 Y 9 43111753 M84K A T missense Het probably damaging 1.000 0.306 04/24/2013
69 30167 UTSW Tmem87b 0.000 R0363 G1 225 Y 2 128831233 S196T T A missense Het probably damaging 0.999 0.470 phenotype 04/24/2013
70 30210 UTSW Tnfrsf21 0.129 R0363 G1 225 Y 17 43037877 T127A A G missense Het probably benign 0.012 0.020 phenotype 04/24/2013
71 30176 UTSW Trp73 0.616 R0363 G1 225 Y 4 154063949 I336T A G missense Het probably benign 0.173 0.157 phenotype 04/24/2013
72 30168 UTSW Ttl 1.000 R0363 G1 225 Y 2 129076061 I148V A G missense Het probably damaging 0.990 0.466 phenotype 04/24/2013
73 30172 UTSW Ttll7 0.511 R0363 G1 225 Y 3 146944215 Y667H T C missense Het probably benign 0.001 0.055 04/24/2013
74 30175 UTSW Ubr4 1.000 R0363 G1 225 Y 4 139391860 T152A A G missense Het probably damaging 0.980 0.244 phenotype 04/24/2013
75 30181 UTSW Vmn1r58 0.060 R0363 G1 212 Y 7 5410637 V198E A T missense Het probably damaging 0.995 0.023 04/24/2013
76 30208 UTSW Vps52 1.000 R0363 G1 225 Y 17 33962117 F376L T A missense Het probably benign 0.261 0.156 phenotype 04/24/2013
[records 1 to 76 of 76]