Incidental Mutations

70 incidental mutations are currently displayed, and affect 70 genes.
11 are Possibly Damaging.
21 are Probably Damaging.
32 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 40320 UTSW Acsm2 0.000 R0416 G1 225 Y 7 119563556 I18V A G missense Het probably benign 0.001 0.110 05/23/2013
2 40345 UTSW Adamdec1 0.069 R0416 G1 225 Y 14 68568712 E438A T G missense Het possibly damaging 0.788 0.062 phenotype 05/23/2013
3 40316 UTSW Adamts17 0.083 R0416 G1 225 Y 7 66915898 A G splice site 4 bp Het probably null 0.650 phenotype 05/23/2013
4 40290 UTSW Ankrd44 0.320 R0416 G1 225 Y 1 54743339 I359L T G missense Het possibly damaging 0.633 0.158 05/23/2013
5 40312 UTSW Ap2s1 0.932 R0416 G1 135 Y 7 16747365 N86K C A missense Het probably damaging 1.000 0.324 phenotype 05/23/2013
6 40327 UTSW Arih1 0.938 R0416 G1 101 Y 9 59426710 T A splice site Het probably benign 05/23/2013
7 40295 UTSW Astn1 0.235 R0416 G1 202 Y 1 158509891 I389N T A missense Het probably damaging 0.998 0.426 phenotype 05/23/2013
8 40307 UTSW Brca2 1.000 R0416 G1 225 Y 5 150569392 S3291P T C missense Het possibly damaging 0.930 0.058 phenotype 05/23/2013
9 40344 UTSW Cacna1d 0.648 R0416 G1 217 Y 14 30100688 T C splice site Het probably benign phenotype 05/23/2013
10 40335 UTSW Ccl7 0.063 R0416 G1 154 Y 11 82045866 C A splice site Het probably benign phenotype 05/23/2013
11 40354 UTSW Cd74 0.184 R0416 G1 225 Y 18 60811414 Y232F A T missense Het possibly damaging 0.902 0.148 phenotype 05/23/2013
12 40341 UTSW Cep128 0.179 R0416 G1 159 Y 12 91230867 A G splice site Het probably benign 0.117 05/23/2013
13 40315 UTSW Cep89 0.151 R0416 G1 225 Y 7 35416402 T A unclassified Het probably benign 0.063 05/23/2013
14 40343 UTSW Cmya5 0.360 R0416 G1 225 Y 13 93089856 N2908T T G missense Het probably benign 0.053 0.122 05/23/2013
15 40336 UTSW Coil 0.130 R0416 G1 211 Y 11 88981986 L391S T C missense Het possibly damaging 0.548 0.162 phenotype 05/23/2013
16 40334 UTSW Cpd 0.907 R0416 G1 204 Y 11 76785204 V1208I C T missense Het probably benign 0.132 0.172 phenotype 05/23/2013
17 40322 UTSW Ddx19a 0.950 R0416 G1 225 Y 8 110979057 D254G T C missense Het probably damaging 0.964 0.414 05/23/2013
18 40296 UTSW Desi2 0.209 R0416 G1 225 Y 1 178256321 T A utr 3 prime Het probably benign 0.082 phenotype 05/23/2013
19 40342 UTSW Dnah11 0.639 R0416 G1 225 Y 12 117911058 M4024K A T missense Het probably damaging 1.000 0.542 phenotype 05/23/2013
20 40310 UTSW Ergic2 0.615 R0416 G1 88 Y 6 148183144 L53H A T missense Het probably damaging 0.997 0.224 phenotype 05/23/2013
21 40313 UTSW Etv2 1.000 R0416 G1 225 Y 7 30634633 Y225C T C missense Het probably benign 0.010 0.122 phenotype 05/23/2013
22 40321 UTSW F10 1.000 R0416 G1 106 Y 8 13055448 A338T G A missense Het probably damaging 1.000 0.210 phenotype 05/23/2013
23 40339 UTSW Fam228b 0.103 R0416 G1 225 Y 12 4762382 D132V T A missense Het probably damaging 0.994 0.222 05/23/2013
24 40330 UTSW Fat2 0.000 R0416 G1 225 Y 11 55284134 I1918F T A missense Het possibly damaging 0.940 0.244 phenotype 05/23/2013
25 40298 UTSW Fbxw5 0.304 R0416 G1 186 Y 2 25503239 S214F C T missense Het probably damaging 0.998 0.288 phenotype 05/23/2013
26 40357 UTSW Glyat 0.000 R0416 G1 225 Y 19 12651453 R204Q G A missense Het possibly damaging 0.865 0.100 phenotype 05/23/2013
27 40350 UTSW Gm4825 0.251 R0416 G1 225 Y 15 85510981 T C exon Het noncoding transcript 0.082 05/23/2013
28 40291 UTSW Ino80d 0.340 R0416 G1 225 N 1 63086276 T9K G T missense Het possibly damaging 0.927 05/23/2013
29 40347 UTSW Lifr 1.000 R0416 G1 208 Y 15 7166914 D193V A T missense Het probably damaging 1.000 0.184 phenotype 05/23/2013
30 40349 UTSW Lrp12 0.121 R0416 G1 225 Y 15 39878911 G T splice site Het probably benign 0.136 phenotype 05/23/2013
31 40314 UTSW Lrp3 0.090 R0416 G1 143 Y 7 35202353 V701A A G missense Het probably benign 0.000 0.092 05/23/2013
32 40338 UTSW Mfsd11 0.118 R0416 G1 151 Y 11 116865882 T A splice site Het probably benign 05/23/2013
33 40303 UTSW Mrto4 0.964 R0416 G1 225 Y 4 139349732 A T splice site Het probably null 0.651 05/23/2013
34 40306 UTSW Msi1 0.365 R0416 G1 225 Y 5 115430649 F43L T C missense Het possibly damaging 0.558 0.126 phenotype 05/23/2013
35 40323 UTSW Mthfsd 0.087 R0416 G1 225 Y 8 121101237 D168G T C missense Het probably damaging 1.000 0.354 05/23/2013
36 40333 UTSW Myo15 0.000 R0416 G1 225 Y 11 60511174 V3099E T A missense Het probably damaging 0.998 0.110 phenotype 05/23/2013
37 40356 UTSW Myrf 0.864 R0416 G1 170 Y 19 10215812 T C critical splice acceptor site Het probably null 0.466 phenotype 05/23/2013
38 40304 UTSW Nadk 0.945 R0416 G1 225 Y 4 155587799 C A splice site Het probably benign phenotype 05/23/2013
39 40293 UTSW Nav1 0.937 R0416 G1 225 Y 1 135471126 K573E T C missense Het possibly damaging 0.728 0.240 phenotype 05/23/2013
40 40300 UTSW Ndufs3 1.000 R0416 G1 225 Y 2 90898388 V207A A G missense Het probably damaging 0.989 0.356 phenotype 05/23/2013
41 40332 UTSW Nlrp3 0.067 R0416 G1 158 Y 11 59555924 T C splice site Het probably benign phenotype 05/23/2013
42 40325 UTSW Nlrx1 0.126 R0416 G1 225 Y 9 44262914 D330A T G missense Het probably benign 0.000 0.120 phenotype 05/23/2013
43 40331 UTSW Olfr331 0.064 R0416 G1 225 Y 11 58502396 I53M T C missense Het unknown 0.058 phenotype 05/23/2013
44 40308 UTSW Olfr444 0.066 R0416 G1 225 Y 6 42955570 C24Y G A missense Het probably benign 0.000 0.115 phenotype 05/23/2013
45 40309 UTSW Osbpl3 0.000 R0416 G1 225 Y 6 50348018 V167I C T missense Het probably benign 0.000 0.098 phenotype 05/23/2013
46 40340 UTSW Pcnx 0.000 R0416 G1 225 Y 12 81974466 I1410F A T missense Het probably benign 0.088 0.062 phenotype 05/23/2013
47 40355 UTSW Piezo2 1.000 R0416 G1 225 Y 18 63024491 R2383C G A missense Het probably damaging 1.000 0.388 phenotype 05/23/2013
48 40299 UTSW Pip5kl1 0.102 R0416 G1 225 Y 2 32583424 K358* A T nonsense Het probably null 0.594 phenotype 05/23/2013
49 40317 UTSW Polg 1.000 R0416 G1 203 Y 7 79452240 T C unclassified Het probably benign phenotype 05/23/2013
50 40305 UTSW Prr14l 0.145 R0416 G1 225 Y 5 32828717 I1145F T A missense Het probably benign 0.246 0.124 05/23/2013
51 40351 UTSW Psmb1 0.936 R0416 G1 208 Y 17 15494519 V39I C T missense Het probably benign 0.004 0.120 phenotype 05/23/2013
52 40301 UTSW Ptk6 0.000 R0416 G1 225 Y 2 181202308 Y66C T C missense Het possibly damaging 0.944 0.476 phenotype 05/23/2013
53 40324 UTSW Robo4 0.281 R0416 G1 225 Y 9 37404766 T C splice site Het probably benign 0.124 phenotype 05/23/2013
54 40337 UTSW Sdk2 0.082 R0416 G1 225 Y 11 113803203 Y1801H A G missense Het probably damaging 1.000 0.326 phenotype 05/23/2013
55 40292 UTSW Serpinb3a 0.113 R0416 G1 225 Y 1 107049386 A95S C A missense Het probably benign 0.289 0.094 phenotype 05/23/2013
56 66511 UTSW Setd1a 1.000 R0416 G1 115 Y 7 127785297 CTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG CTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG unclassified Het probably benign phenotype 08/19/2013
57 40326 UTSW Sik2 0.807 R0416 G1 203 Y 9 50995632 Y98N A T missense Het probably damaging 0.999 0.384 phenotype 05/23/2013
58 40297 UTSW Slc30a1 1.000 R0416 G1 225 Y 1 191909726 P495S C T missense Het probably benign 0.230 0.026 phenotype 05/23/2013
59 40319 UTSW Smg1 1.000 R0416 G1 146 Y 7 118184461 A T splice site Het probably benign phenotype 05/23/2013
60 40348 UTSW Stk3 0.000 R0416 G1 206 Y 15 35114632 I45L T A missense Het probably benign 0.074 0.124 phenotype 05/23/2013
61 40353 UTSW Tapbp 0.090 R0416 G1 95 Y 17 33925418 T163A A G missense Het probably damaging 0.992 0.164 phenotype 05/23/2013
62 40294 UTSW Tdrd5 0.299 R0416 G1 225 Y 1 156285481 K410E T C missense Het probably damaging 0.961 0.026 phenotype 05/23/2013
63 40318 UTSW Trim30b 0.000 R0416 G1 225 Y 7 104363766 M152K A T missense Het probably benign 0.081 0.036 05/23/2013
64 40358 UTSW Trpm6 1.000 R0416 G1 225 Y 19 18783025 G T splice site Het probably benign phenotype 05/23/2013
65 40346 UTSW Tsc22d1 0.219 R0416 G1 225 Y 14 76505303 T C splice site Het probably benign phenotype 05/23/2013
66 40328 UTSW U2surp 0.955 R0416 G1 225 Y 9 95485607 F444I A T missense Het probably damaging 0.999 0.538 05/23/2013
67 40352 UTSW Vmn2r95 0.277 R0416 G1 193 Y 17 18441402 P470L C T missense Het probably damaging 0.998 0.039 05/23/2013
68 40311 UTSW Zc3h4 1.000 R0416 G1 225 Y 7 16420275 Y163D T G missense Het probably damaging 0.999 0.168 phenotype 05/23/2013
69 40329 UTSW Zfp62 0.144 R0416 G1 225 Y 11 49215676 H198L A T missense Het probably damaging 0.998 0.566 05/23/2013
70 40302 UTSW Zmym1 0.294 R0416 G1 218 Y 4 127058820 L56P A G missense Het probably benign 0.003 0.150 05/23/2013
[records 1 to 70 of 70]