Incidental Mutations

83 incidental mutations are currently displayed, and affect 83 genes.
16 are Possibly Damaging.
30 are Probably Damaging.
15 are Probably Benign.
20 are Probably Null.
7 create premature stop codons.
10 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 83 of 83] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 48351 UTSW 1700061G19Rik 0.152 R0518 G1 225 N 17 56885169 Y577* T A nonsense Het probably null 0.620 06/12/2013
2 48345 UTSW 2900011O08Rik 0.280 R0518 G1 225 N 16 13986812 S8T T A missense Het possibly damaging 0.942 06/12/2013
3 48328 UTSW Acaca 1.000 R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
4 48301 UTSW Acsm5 0.161 R0518 G1 225 N 7 119535800 V327A T C missense Het possibly damaging 0.949 06/12/2013
5 48310 UTSW Agt 0.209 R0518 G1 220 N 8 124557100 E427* C A nonsense Het probably null phenotype 06/12/2013
6 48333 UTSW Akr1c14 0.107 R0518 G1 143 N 13 4081016 L236S T C missense Het probably damaging 1.000 06/12/2013
7 48355 UTSW Ammecr1l 0.281 R0518 G1 225 N 18 31771901 S65L C T missense Het probably benign 0.300 06/12/2013
8 48340 UTSW Ankrd33b 0.111 R0518 G1 225 N 15 31367286 D36G T C missense Het probably damaging 0.989 06/12/2013
9 48307 UTSW Ano8 0.274 R0518 G1 225 N 8 71479258 C766S A T missense Het probably benign 0.387 06/12/2013
10 48285 UTSW Arhgef16 0.151 R0518 G1 225 N 4 154291034 P168T G T missense Het probably damaging 0.991 phenotype 06/12/2013
11 48344 UTSW Asic1 0.184 R0518 G1 191 N 15 99698819 R499C C T missense Het probably damaging 0.995 phenotype 06/12/2013
12 48278 UTSW Bank1 0.256 R0518 G1 225 N 3 136213942 C364Y C T missense Het probably damaging 1.000 phenotype 06/12/2013
13 48266 UTSW Cacna1s 1.000 R0518 G1 225 N 1 136076859 D132E C A missense Het probably benign 0.000 phenotype 06/12/2013
14 48297 UTSW Capn5 0.121 R0518 G1 208 N 7 98132882 R217Q C T missense Het probably damaging 0.995 phenotype 06/12/2013
15 48295 UTSW Clasrp 1.000 R0518 G1 123 N 7 19588603 I284T A G missense Het probably benign 0.316 phenotype 06/12/2013
16 48330 UTSW Coa3 0.546 R0518 G1 225 N 11 101278890 K13M T A missense Het probably damaging 1.000 phenotype 06/12/2013
17 48318 UTSW Col13a1 0.000 R0518 G1 225 N 10 61862746 M512K A T missense Het unknown phenotype 06/12/2013
18 48267 UTSW Colgalt2 0.096 R0518 G1 225 N 1 152508561 A551S G T missense Het possibly damaging 0.675 0.140 06/12/2013
19 48337 UTSW Crhbp 0.131 R0518 G1 113 N 13 95443895 C A critical splice acceptor site Het probably null phenotype 06/12/2013
20 48263 UTSW Cryba2 0.212 R0518 G1 225 N 1 74890125 Y153C T C missense Het possibly damaging 0.909 phenotype 06/12/2013
21 48270 UTSW Cryzl2 0.088 R0518 G1 225 N 1 157464430 V93A T C missense Het probably damaging 0.999 06/12/2013
22 48336 UTSW Ctsl 1.000 R0518 G1 199 N 13 64365218 L297F G A missense Het possibly damaging 0.747 phenotype 06/12/2013
23 48300 UTSW Cyp2r1 0.192 R0518 G1 181 N 7 114552900 H274P T G missense Het probably benign 0.012 phenotype 06/12/2013
24 48338 UTSW Ddx4 0.484 R0518 G1 208 N 13 112624779 A T critical splice donor site 2 bp Het probably null phenotype 06/12/2013
25 48279 UTSW Ddx58 0.431 R0518 G1 209 N 4 40216354 C T critical splice donor site 1 bp Het probably null phenotype 06/12/2013
26 48356 UTSW Dnd1 0.000 R0518 G1 222 N 18 36764043 V350A A G missense Het possibly damaging 0.685 phenotype 06/12/2013
27 48354 UTSW Dsg1b 0.239 R0518 G1 225 N 18 20388164 Q26L A T missense Het probably benign 0.003 phenotype 06/12/2013
28 48341 UTSW Fam173b 0.184 R0518 G1 225 N 15 31605957 S20R T G missense Het probably benign 0.046 06/12/2013
29 48269 UTSW Fam20b 1.000 R0518 G1 199 N 1 156687456 V280F C A missense Het possibly damaging 0.700 phenotype 06/12/2013
30 48358 UTSW Foxb2 0.429 R0518 G1 132 N 19 16872456 C395* G T nonsense Het probably null 06/12/2013
31 66958 UTSW Glb1 0.000 R0518 G1 217 N 9 114421744 ACCC ACC frame shift Het probably null phenotype 08/19/2013
32 48316 UTSW Gm9930 0.215 R0518 G1 225 N 10 9534803 A T exon Het noncoding transcript 06/12/2013
33 48343 UTSW Hdac7 1.000 R0518 G1 218 N 15 97806499 Q497* G A nonsense Het probably null phenotype 06/12/2013
34 48334 UTSW Hk3 0.072 R0518 G1 225 N 13 55014426 C T critical splice donor site 1 bp Het probably null phenotype 06/12/2013
35 48302 UTSW Hsd3b7 0.000 R0518 G1 187 N 7 127803079 T330A A G missense Het probably benign 0.008 phenotype 06/12/2013
36 48317 UTSW Il20ra 0.000 R0518 G1 225 N 10 19759640 Q543L A T missense Het probably damaging 0.998 phenotype 06/12/2013
37 48322 UTSW Itk 0.325 R0518 G1 128 N 11 46360288 D163V T A missense Het probably damaging 0.981 phenotype 06/12/2013
38 48304 UTSW Kcnu1 0.000 R0518 G1 225 N 8 25910888 L688R T G missense Het probably damaging 1.000 phenotype 06/12/2013
39 48347 UTSW Kng1 0.000 R0518 G1 225 N 16 23060482 A45T G A missense Het possibly damaging 0.696 phenotype 06/12/2013
40 48283 UTSW Kti12 0.941 R0518 G1 225 N 4 108848579 V230E T A missense Het possibly damaging 0.950 06/12/2013
41 48264 UTSW Mgat5 0.000 R0518 G1 214 N 1 127384847 I241N T A missense Het probably damaging 1.000 phenotype 06/12/2013
42 48289 UTSW Mkln1 0.321 R0518 G1 225 N 6 31468132 N321S A G missense Het probably benign 0.001 phenotype 06/12/2013
43 48272 UTSW Mllt10 0.565 R0518 G1 224 N 2 18071206 T G critical splice donor site 2 bp Het probably null phenotype 06/12/2013
44 48357 UTSW Ms4a1 0.000 R0518 G1 225 N 19 11258679 C A splice site 5 bp Het probably null phenotype 06/12/2013
45 48339 UTSW Ngly1 0.710 R0518 G1 225 N 14 16290774 Q419* C T nonsense Het probably null phenotype 06/12/2013
46 48280 UTSW Nipsnap3b 0.144 R0518 G1 225 N 4 53021343 F243I T A missense Het probably damaging 0.994 phenotype 06/12/2013
47 48308 UTSW Ogfod1 0.000 R0518 G1 181 N 8 94055248 T A splice site Het probably null phenotype 06/12/2013
48 48323 UTSW Olfr1381 0.136 R0518 G1 165 N 11 49552464 T239M C T missense Het probably damaging 1.000 phenotype 06/12/2013
49 48298 UTSW Olfr624 0.204 R0518 G1 225 N 7 103670489 I181F T A missense Het possibly damaging 0.564 phenotype 06/12/2013
50 48299 UTSW Olfr714 0.082 R0518 G1 225 N 7 107074758 L310Q T A missense Het possibly damaging 0.807 phenotype 06/12/2013
51 48312 UTSW Olfr898 0.266 R0518 G1 225 N 9 38349203 N40T A C missense Het probably damaging 0.994 phenotype 06/12/2013
52 48276 UTSW P2ry14 0.000 R0518 G1 225 N 3 59115204 E287D T A missense Het probably damaging 1.000 phenotype 06/12/2013
53 48286 UTSW Pank4 0.298 R0518 G1 225 N 4 154976625 R510S A T missense Het possibly damaging 0.905 phenotype 06/12/2013
54 48296 UTSW Pcsk6 0.260 R0518 G1 225 N 7 65980167 V347E T A missense Het possibly damaging 0.645 phenotype 06/12/2013
55 48294 UTSW Peg3 0.000 R0518 G1 225 N 7 6711428 E265G T C missense Het probably damaging 1.000 phenotype 06/12/2013
56 48265 UTSW Pik3c2b 0.237 R0518 G1 214 N 1 133105992 P1578H C A missense Het probably damaging 1.000 phenotype 06/12/2013
57 48349 UTSW Pkd1 1.000 R0518 G1 225 N 17 24595219 S4188G A G missense Het probably benign 0.012 phenotype 06/12/2013
58 48273 UTSW Ppp1r26 0.145 R0518 G1 225 N 2 28452302 D648G A G missense Het probably damaging 1.000 06/12/2013
59 48350 UTSW Ptprs 0.499 R0518 G1 225 N 17 56419621 A G critical splice donor site 2 bp Het probably null phenotype 06/12/2013
60 48335 UTSW Rab24 0.165 R0518 G1 225 N 13 55320925 A T critical splice donor site 2 bp Het probably null phenotype 06/12/2013
61 48327 UTSW Rap1gap2 0.449 R0518 G1 147 N 11 74441766 M71K A T missense Het probably damaging 0.998 phenotype 06/12/2013
62 48292 UTSW Rergl 0.077 R0518 G1 225 N 6 139496526 K42T T G missense Het probably damaging 1.000 06/12/2013
63 48346 UTSW Sept5 0.282 R0518 G1 225 N 16 18624897 T92A T C missense Het probably benign 0.021 phenotype 06/12/2013
64 48287 UTSW Ski 1.000 R0518 G1 84 N 4 155159286 A G critical splice donor site 2 bp Het probably null phenotype 06/12/2013
65 48319 UTSW Slc17a8 0.172 R0518 G1 225 N 10 89576330 S414P A G missense Het probably benign 0.001 phenotype 06/12/2013
66 48314 UTSW Slc25a36 0.257 R0518 G1 151 N 9 97097175 I71N A T missense Het probably damaging 0.999 06/12/2013
67 48332 UTSW Syne2 0.317 R0518 G1 142 N 12 76108862 A C critical splice acceptor site Het probably null phenotype 06/12/2013
68 48268 UTSW Tdrd5 0.221 R0518 G1 180 N 1 156262941 W845L C A missense Het probably damaging 0.991 phenotype 06/12/2013
69 48271 UTSW Tfb2m 0.897 R0518 G1 225 N 1 179537824 I192V T C missense Het possibly damaging 0.469 06/12/2013
70 48305 UTSW Tll1 1.000 R0518 G1 187 N 8 64098471 D292A T G missense Het probably damaging 1.000 phenotype 06/12/2013
71 48288 UTSW Tmem211 0.090 R0518 G1 202 N 5 113236007 L97* T A nonsense Het probably null 06/12/2013
72 48315 UTSW Trank1 0.000 R0518 G1 200 N 9 111333808 D45A A C missense Het probably damaging 1.000 06/12/2013
73 48324 UTSW Trim17 0.036 R0518 G1 225 N 11 58968494 V178E T A missense Het probably damaging 0.988 phenotype 06/12/2013
74 48331 UTSW Trim9 0.205 R0518 G1 208 N 12 70346585 L195Q A T missense Het probably damaging 0.988 phenotype 06/12/2013
75 48353 UTSW Ttc27 0.893 R0518 G1 225 N 17 74856549 R717S A T missense Het possibly damaging 0.795 06/12/2013
76 48313 UTSW Upk2 0.110 R0518 G1 225 N 9 44454121 P50Q G T missense Het probably damaging 1.000 phenotype 06/12/2013
77 48359 UTSW Usp9y 0.064 R0518 G1 225 N Y 1307880 C2319S A T missense Het probably benign 0.000 phenotype 06/12/2013
78 48290 UTSW Vmn1r4 0.069 R0518 G1 225 N 6 56956898 C129F G T missense Het probably benign 0.000 06/12/2013
79 48348 UTSW Vmn2r100 0.068 R0518 G1 225 N 17 19521916 D184V A T missense Het probably damaging 0.997 06/12/2013
80 48282 UTSW Wdr78 0.170 R0518 G1 225 N 4 103064530 Y464* A C nonsense Het probably null 06/12/2013
81 48342 UTSW Xpnpep3 0.000 R0518 G1 225 N 15 81427492 I133S T G missense Het possibly damaging 0.937 06/12/2013
82 48293 UTSW Zfp628 0.435 R0518 G1 185 N 7 4919940 Q387L A T missense Het probably damaging 0.967 phenotype 06/12/2013
83 66959 UTSW Zic2 0.823 R0518 G1 105 N 14 122476364 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC small deletion Het probably benign 0.045 phenotype 08/19/2013
[records 1 to 83 of 83]