Incidental Mutations

38 incidental mutations are currently displayed, and affect 37 genes.
6 are Possibly Damaging.
10 are Probably Damaging.
13 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 38 of 38] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 46269 UTSW 1810043G02Rik 0.000 R0568 G1 172 Y 10 77983038 T181I C T missense Het possibly damaging 0.484 0.064 phenotype 06/11/2013
2 46270 UTSW 1810043G02Rik 0.000 R0568 G1 225 Y 10 77984547 *250C A T makesense Het probably null 0.530 phenotype 06/11/2013
3 46251 UTSW Acnat1 0.065 R0568 G1 176 Y 4 49451003 T36I G A missense Het possibly damaging 0.931 0.046 06/11/2013
4 46276 UTSW Adamts20 0.163 R0568 G1 139 Y 15 94291713 T C splice site Het probably benign 0.109 phenotype 06/11/2013
5 46252 UTSW Adamtsl1 0.155 R0568 G1 225 Y 4 86418552 L1558S T C missense Het probably damaging 1.000 0.037 phenotype 06/11/2013
6 46263 UTSW Ap3b2 0.129 R0568 G1 225 Y 7 81464629 A G critical splice donor site 2 bp Het probably null 0.448 phenotype 06/11/2013
7 46242 UTSW Bag2 0.152 R0568 G1 225 Y 1 33746978 M88V T C missense Het probably benign 0.006 0.180 phenotype 06/11/2013
8 46272 UTSW Brms1l 0.928 R0568 G1 225 Y 12 55861388 A G critical splice acceptor site Het probably null 0.610 phenotype 06/11/2013
9 46253 UTSW C8b 0.000 R0568 G1 225 Y 4 104793380 I462V A G missense Het probably benign 0.394 0.056 phenotype 06/11/2013
10 46259 UTSW Cnpy4 0.125 R0568 G1 225 Y 5 138192577 E167G A G missense Het probably damaging 1.000 0.570 phenotype 06/11/2013
11 46243 UTSW Copa 0.968 R0568 G1 225 Y 1 172112137 V624A T C missense Het possibly damaging 0.913 0.280 phenotype 06/11/2013
12 46265 UTSW Gm4553 R0568 G1 160 N 7 142165620 P24T G T missense Het unknown 06/11/2013
13 46260 UTSW Gna12 0.460 R0568 G1 225 Y 5 140760883 V269A A G missense Het possibly damaging 0.745 0.078 phenotype 06/11/2013
14 46258 UTSW Gtf2ird2 0.099 R0568 G1 225 Y 5 134211242 E302* G T nonsense Het probably null 0.634 06/11/2013
15 46246 UTSW Hmcn2 0.000 R0568 G1 225 Y 2 31415236 S3140R C A missense Het probably benign 0.018 0.054 06/11/2013
16 46271 UTSW Hspa4 0.883 R0568 G1 225 Y 11 53262876 A G splice site Het probably benign 0.062 phenotype 06/11/2013
17 46261 UTSW Hspbp1 0.110 R0568 G1 225 Y 7 4684432 L60* A T nonsense Het probably null 0.634 phenotype 06/11/2013
18 46267 UTSW Lats1 0.845 R0568 G1 225 Y 10 7712528 I970F A T missense Het possibly damaging 0.692 0.188 phenotype 06/11/2013
19 46278 UTSW Lipo3 0.063 R0568 G1 225 Y 19 33582042 T C splice site Het probably benign 06/11/2013
20 46268 UTSW Lrrc3 0.000 R0568 G1 172 Y 10 77901585 R6W T A missense Het probably damaging 0.964 0.036 06/11/2013
21 46249 UTSW Lxn 0.485 R0568 G1 225 Y 3 67461002 A143T C T missense Het probably damaging 1.000 0.412 phenotype 06/11/2013
22 46248 UTSW Mga 0.942 R0568 G1 225 Y 2 119935422 I1390T T C missense Het probably damaging 1.000 0.180 phenotype 06/11/2013
23 46273 UTSW Ncapg2 1.000 R0568 G1 225 Y 12 116423215 I286N T A missense Het probably damaging 0.999 0.268 phenotype 06/11/2013
24 46247 UTSW Olfr1212 0.060 R0568 G1 225 Y 2 88959043 Y192* T A nonsense Het probably null 0.620 phenotype 06/11/2013
25 46274 UTSW Papd4 0.417 R0568 G1 225 Y 13 93154992 S381P A G missense Het probably benign 0.198 0.318 phenotype 06/11/2013
26 46257 UTSW Pitpnm2 0.000 R0568 G1 217 Y 5 124140517 A G splice site Het probably benign phenotype 06/11/2013
27 46244 UTSW Plxna2 0.000 R0568 G1 225 Y 1 194751386 V581A T C missense Het probably benign 0.001 0.120 phenotype 06/11/2013
28 46275 UTSW Polr3d 0.922 R0568 G1 225 Y 14 70439519 H378Q A T missense Het possibly damaging 0.813 0.068 phenotype 06/11/2013
29 46256 UTSW Ptpn13 0.294 R0568 G1 225 Y 5 103489765 V173A T C missense Het probably damaging 0.998 0.098 phenotype 06/11/2013
30 67000 UTSW Rbpms2 0.000 R0568 G1 217 Y 9 65651666 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC unclassified Het probably benign 0.070 phenotype 08/20/2013
31 46250 UTSW Smc4 0.968 R0568 G1 225 Y 3 69022461 T C critical splice donor site 2 bp Het probably null 0.538 phenotype 06/11/2013
32 46254 UTSW Snrnp40 1.000 R0568 G1 225 Y 4 130378043 C G splice site Het probably null 0.603 phenotype 06/11/2013
33 46277 UTSW Syngr3 0.000 R0568 G1 176 Y 17 24686581 A140T C T missense Het probably benign 0.001 0.071 phenotype 06/11/2013
34 46245 UTSW Tprn 0.000 R0568 G1 225 Y 2 25264321 V545A T C missense Het probably damaging 1.000 0.190 phenotype 06/11/2013
35 46264 UTSW Trim66 0.229 R0568 G1 225 Y 7 109460695 H828R T C missense Het probably benign 0.005 0.120 06/11/2013
36 46255 UTSW Ugt2b5 0.061 R0568 G1 225 Y 5 87137365 G A critical splice acceptor site Het probably benign 0.110 06/11/2013
37 46266 UTSW Vps9d1 0.000 R0568 G1 116 Y 8 123246748 V432A A G missense Het probably damaging 0.999 0.160 06/11/2013
38 46262 UTSW Zswim9 0.071 R0568 G1 225 Y 7 13261026 D401E A T missense Het probably damaging 0.993 0.029 06/11/2013
[records 1 to 38 of 38]