Incidental Mutations

38 incidental mutations are currently displayed, and affect 38 genes.
6 are Possibly Damaging.
9 are Probably Damaging.
19 are Probably Benign.
4 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 38 of 38] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 81953 UTSW 4833423E24Rik 0.063 R0943 G1 225 Y 2 85488765 D398N C T missense Het probably damaging 0.989 0.026 11/08/2013
2 81969 UTSW A230050P20Rik 0.320 R0943 G1 205 N 9 20872962 H160L A T missense Het possibly damaging 0.808 11/08/2013
3 81978 UTSW Agtpbp1 0.651 R0943 G1 225 Y 13 59500602 N468S T C missense Het probably benign 0.000 0.008 phenotype 11/08/2013
4 81980 UTSW Card6 0.000 R0943 G1 225 Y 15 5100286 S543P A G missense Het probably damaging 0.999 0.272 phenotype 11/08/2013
5 81982 UTSW Celsr1 0.649 R0943 G1 174 Y 15 85903288 T2750P T G missense Het probably damaging 0.998 0.104 phenotype 11/08/2013
6 81981 UTSW Csmd3 0.848 R0943 G1 225 Y 15 47675739 M2341T A G missense Het probably damaging 0.993 0.096 11/08/2013
7 81985 UTSW Dym 0.177 R0943 G1 225 Y 18 75286769 *670W A G makesense Het probably null 0.490 phenotype 11/08/2013
8 81974 UTSW Ehbp1 0.708 R0943 G1 225 Y 11 22095883 D597G T C missense Het probably benign 0.115 0.200 phenotype 11/08/2013
9 81962 UTSW Emx1 0.000 R0943 G1 225 Y 6 85203919 W206* G A nonsense Het probably null 0.572 phenotype 11/08/2013
10 81971 UTSW Esr1 0.834 R0943 G1 194 Y 10 4746781 K210R A G missense Het probably damaging 1.000 0.342 phenotype 11/08/2013
11 81957 UTSW Extl1 0.500 R0943 G1 108 Y 4 134357677 TGCGTTGCACCGATACCGGG TG unclassified Het probably benign 0.107 phenotype 11/08/2013
12 81949 UTSW Fam72a 0.197 R0943 G1 225 Y 1 131528779 S27P T C missense Het possibly damaging 0.816 0.194 11/08/2013
13 81968 UTSW Fanca 0.721 R0943 G1 225 Y 8 123274186 C1152S A T missense Het probably damaging 0.999 0.140 phenotype 11/08/2013
14 81959 UTSW Fras1 0.000 R0943 G1 225 Y 5 96726543 V2276I G A missense Het probably benign 0.004 0.066 phenotype 11/08/2013
15 81961 UTSW Gm9008 0.138 R0943 G1 225 Y 6 76496415 H406R T C missense Het probably benign 0.092 0.102 11/08/2013
16 81976 UTSW Hoxb13 0.000 R0943 G1 225 Y 11 96195973 E202G A G missense Het probably benign 0.000 0.102 phenotype 11/08/2013
17 81964 UTSW Lcmt1 1.000 R0943 G1 225 Y 7 123401439 T G splice site Het probably null 0.626 phenotype 11/08/2013
18 81983 UTSW Mettl7a1 0.275 R0943 G1 225 Y 15 100304958 Y20H T C missense Het probably benign 0.191 0.024 11/08/2013
19 81963 UTSW Nars2 0.953 R0943 G1 225 Y 7 96955931 C T splice site Het probably benign 0.065 phenotype 11/08/2013
20 81966 UTSW Neil3 0.337 R0943 G1 150 Y 8 53609369 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT unclassified Het probably benign phenotype 11/08/2013
21 81977 UTSW Nup153 0.930 R0943 G1 225 Y 13 46696772 T C splice site Het probably benign 0.096 phenotype 11/08/2013
22 81954 UTSW Olfr1257 0.071 R0943 G1 225 Y 2 89880961 V45A T C missense Het probably benign 0.112 0.123 phenotype 11/08/2013
23 81987 UTSW Olfr1466 0.051 R0943 G1 225 Y 19 13341793 H12N C A missense Het probably benign 0.001 0.130 phenotype 11/08/2013
24 81970 UTSW Prkar2a 0.000 R0943 G1 225 Y 9 108733276 T C splice site Het probably benign phenotype 11/08/2013
25 81950 UTSW Ptprc 0.271 R0943 G1 225 Y 1 138111164 T209A T C missense Het probably damaging 0.964 0.158 phenotype 11/08/2013
26 81951 UTSW Rif1 1.000 R0943 G1 217 Y 2 52110324 GCCACCA GCCA unclassified Het probably benign 0.052 phenotype 11/08/2013
27 81955 UTSW Rprd2 0.431 R0943 G1 225 Y 3 95784247 V239I C T missense Het possibly damaging 0.880 0.112 11/08/2013
28 81967 UTSW Sgo2b 0.153 R0943 G1 126 N 8 63931335 F209S A G missense Het possibly damaging 0.816 11/08/2013
29 81979 UTSW Spry2 0.733 R0943 G1 225 Y 14 105893587 Y55C T C missense Het probably damaging 1.000 0.172 phenotype 11/08/2013
30 81972 UTSW Tbc1d32 0.860 R0943 G1 225 Y 10 56161147 V667E A T missense Het probably benign 0.000 0.131 phenotype 11/08/2013
31 81973 UTSW Tbrg4 0.685 R0943 G1 225 Y 11 6619008 F388L A G missense Het probably damaging 0.998 0.202 11/08/2013
32 81986 UTSW Tshz1 1.000 R0943 G1 225 Y 18 84015231 T351A T C missense Het probably benign 0.044 0.066 phenotype 11/08/2013
33 81958 UTSW Usp48 0.911 R0943 G1 225 Y 4 137644470 N969S A G missense Het possibly damaging 0.915 0.372 phenotype 11/08/2013
34 81984 UTSW Vmn2r108 0.080 R0943 G1 225 Y 17 20471135 C375* A T nonsense Het probably null 0.629 11/08/2013
35 81956 UTSW Vps45 0.877 R0943 G1 225 Y 3 96057024 I62F T A missense Het probably benign 0.016 0.058 phenotype 11/08/2013
36 81965 UTSW Xab2 1.000 R0943 G1 225 Y 8 3613667 F388L A G missense Het probably benign 0.001 0.070 phenotype 11/08/2013
37 81975 UTSW Zfp735 0.079 R0943 G1 225 Y 11 73712083 T618A A G missense Het probably benign 0.036 0.034 11/08/2013
38 81952 UTSW Zswim2 0.083 R0943 G1 225 Y 2 83917998 R279S T A missense Het possibly damaging 0.884 0.064 11/08/2013
[records 1 to 38 of 38]