Incidental Mutations

39 incidental mutations are currently displayed, and affect 38 genes.
3 are Possibly Damaging.
12 are Probably Damaging.
18 are Probably Benign.
6 are Probably Null.
4 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 39 of 39] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 152454 UTSW Abcg3 0.109 R1237 G1 225 Y 5 104948357 T500A T C missense Het probably damaging 0.959 0.002 phenotype 01/29/2014
2 152456 UTSW Amz1 0.112 R1237 G1 197 Y 5 140741284 M1L A T start codon destroyed Het probably damaging 0.982 0.110 01/29/2014
3 152447 UTSW Angptl1 0.174 R1237 G1 225 Y 1 156858584 N413K T A missense Het probably damaging 0.999 0.292 phenotype 01/29/2014
4 152467 UTSW Ankrd13b 0.263 R1237 G1 225 Y 11 77474574 T70A T C missense Het probably damaging 0.999 0.390 01/29/2014
5 152458 UTSW Cacna1c 0.788 R1237 G1 225 Y 6 118612625 R1446H C T missense Het probably damaging 1.000 0.036 phenotype 01/29/2014
6 152457 UTSW Ccdc174 1.000 R1237 G1 225 Y 6 91890787 C T splice site Het probably benign 0.073 phenotype 01/29/2014
7 152452 UTSW Ccnc 1.000 R1237 G1 225 Y 4 21730457 F31L T A missense Het probably benign 0.000 0.102 phenotype 01/29/2014
8 152475 UTSW Celsr1 0.649 R1237 G1 144 Y 15 85903974 S2692R A C missense Het probably benign 0.009 0.130 phenotype 01/29/2014
9 152451 UTSW Chd1l 0.229 R1237 G1 225 Y 3 97582731 E503K C T missense Het probably benign 0.013 0.103 phenotype 01/29/2014
10 152472 UTSW Ddhd1 0.221 R1237 G1 225 Y 14 45601650 D65E A T missense Het probably benign 0.006 0.153 phenotype 01/29/2014
11 152469 UTSW Dync1h1 1.000 R1237 G1 225 Y 12 110665959 N4504S A G missense Het probably benign 0.002 0.094 phenotype 01/29/2014
12 152474 UTSW Enthd1 0.094 R1237 G1 225 Y 15 80534598 S167P A G missense Het probably damaging 1.000 0.122 01/29/2014
13 152460 UTSW Fat1 1.000 R1237 G1 225 Y 8 45044279 Y4267F A T missense Het probably damaging 0.998 0.332 phenotype 01/29/2014
14 152455 UTSW Hectd4 0.424 R1237 G1 225 Y 5 121321507 A813V C T missense Het possibly damaging 0.904 0.270 01/29/2014
15 152461 UTSW Ibtk 0.000 R1237 G1 225 Y 9 85720748 S735G T C missense Het probably benign 0.003 0.080 phenotype 01/29/2014
16 152449 UTSW Itga4 1.000 R1237 G1 225 Y 2 79279146 I230V A G missense Het probably null 0.077 0.100 phenotype 01/29/2014
17 152481 UTSW Kcnh8 0.378 R1237 G1 225 Y 17 52893960 Q474L A T missense Het probably damaging 0.999 0.458 phenotype 01/29/2014
18 152482 UTSW Kcnh8 0.378 R1237 G1 225 Y 17 52893961 Q474H G T missense Het probably damaging 1.000 0.368 phenotype 01/29/2014
19 152483 UTSW Mib1 1.000 R1237 G1 225 Y 18 10768149 T466I C T missense Het probably damaging 1.000 0.462 phenotype 01/29/2014
20 152480 UTSW Olfr101 0.091 R1237 G1 225 Y 17 37300265 R52S T A missense Het probably benign 0.186 0.147 phenotype 01/29/2014
21 152470 UTSW Olfr1368 0.063 R1237 G1 225 Y 13 21142167 V297I C T missense Het probably benign 0.163 0.126 phenotype 01/29/2014
22 152476 UTSW Olfr167 0.081 R1237 G1 225 Y 16 19515625 Y4D A C missense Het probably benign 0.015 0.123 phenotype 01/29/2014
23 152477 UTSW Parp14 0.421 R1237 G1 225 Y 16 35856760 A946V G A missense Het probably benign 0.089 0.072 phenotype 01/29/2014
24 152450 UTSW Prdx6b 0.127 R1237 G1 225 Y 2 80293176 I110V A G missense Het probably benign 0.043 0.162 phenotype 01/29/2014
25 152463 UTSW Prf1 0.000 R1237 G1 225 Y 10 61303649 D462A A C missense Het probably benign 0.003 0.127 phenotype 01/29/2014
26 152468 UTSW Rps6ka5 0.000 R1237 G1 225 Y 12 100575705 D391G T C missense Het possibly damaging 0.845 0.174 phenotype 01/29/2014
27 152448 UTSW Scn7a 0.271 R1237 G1 225 Y 2 66680295 N1254K A T missense Het probably damaging 0.980 0.118 phenotype 01/29/2014
28 152484 UTSW Skor2 1.000 R1237 G1 225 Y 18 76876132 K924* A T nonsense Het probably null 0.570 phenotype 01/29/2014
29 152466 UTSW Slc22a21 0.106 R1237 G1 220 Y 11 53979772 I29T A G missense Het probably benign 0.358 0.256 phenotype 01/29/2014
30 152459 UTSW Tas2r140 0.069 R1237 G1 225 Y 6 133055208 T196A T C missense Het probably benign 0.040 0.131 phenotype 01/29/2014
31 152453 UTSW Thrap3 0.255 R1237 G1 225 Y 4 126180069 S295P A G missense Het probably benign 0.024 0.090 01/29/2014
32 152462 UTSW Trim43a 0.122 R1237 G1 172 Y 9 88582989 GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT intron Het probably benign 0.124 01/29/2014
33 152465 UTSW Ubtd2 0.206 R1237 G1 225 Y 11 32516125 R115W C T missense Het probably damaging 1.000 0.028 01/29/2014
34 152485 UTSW Unc93b1 0.000 R1237 G1 225 Y 19 3935228 E12G A G missense Het possibly damaging 0.719 0.045 phenotype 01/29/2014
35 152478 UTSW Vgll3 0.210 R1237 G1 222 Y 16 65839573 Y203* T A nonsense Het probably null 0.662 01/29/2014
36 152471 UTSW Vmn1r212 0.094 R1237 G1 225 Y 13 22883468 Q232* G A nonsense Het probably null 0.657 01/29/2014
37 152479 UTSW Vmn2r107 0.235 R1237 G1 225 Y 17 20356685 L315* T A nonsense Het probably null 0.661 01/29/2014
38 152464 UTSW Vmn2r84 0.046 R1237 G1 225 Y 10 130387856 T A splice site 3 bp Het probably null 0.635 01/29/2014
39 152473 UTSW Washc5 0.932 R1237 G1 225 Y 15 59338908 A G splice site Het probably benign phenotype 01/29/2014
[records 1 to 39 of 39]