Incidental Mutations

61 incidental mutations are currently displayed, and affect 61 genes.
11 are Possibly Damaging.
22 are Probably Damaging.
20 are Probably Benign.
6 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 61 of 61] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 151929 UTSW Abcb9 0.184 R1240 G1 177 N 5 124089921 I86L T G missense Het probably benign 0.024 phenotype 01/29/2014
2 151948 UTSW Ankfn1 0.323 R1240 G1 117 N 11 89392134 L229P A G missense Het probably damaging 0.993 phenotype 01/29/2014
3 151932 UTSW Aoc1 0.287 R1240 G1 225 N 6 48905615 S164P T C missense Het probably benign 0.101 phenotype 01/29/2014
4 151955 UTSW Arhgef28 0.500 R1240 G1 225 N 13 97929492 V1618I C T missense Het probably benign 0.004 phenotype 01/29/2014
5 151928 UTSW Arpc3 1.000 R1240 G1 225 N 5 122404179 F88S T C missense Het probably damaging 1.000 phenotype 01/29/2014
6 151945 UTSW Asgr2 0.209 R1240 G1 225 N 11 70096850 R58L G T missense Het possibly damaging 0.810 phenotype 01/29/2014
7 151919 UTSW Bach2 0.000 R1240 G1 225 N 4 32563198 F432S T C missense Het probably damaging 1.000 phenotype 01/29/2014
8 151953 UTSW Brms1l 0.688 R1240 G1 225 N 12 55844508 R116S C A missense Het probably damaging 1.000 phenotype 01/29/2014
9 151931 UTSW Casp2 0.208 R1240 G1 225 N 6 42268945 C179S T A missense Het probably damaging 0.999 phenotype 01/29/2014
10 151914 UTSW Ccdc73 0.161 R1240 G1 225 N 2 104991561 E618D A T missense Het probably benign 0.046 01/29/2014
11 151957 UTSW Cdh6 0.362 R1240 G1 225 N 15 13057455 D260V T A missense Het possibly damaging 0.478 phenotype 01/29/2014
12 151927 UTSW Cenpc1 1.000 R1240 G1 225 N 5 86035510 N473K G T missense Het probably benign 0.316 phenotype 01/29/2014
13 151941 UTSW Chst2 0.118 R1240 G1 182 N 9 95405483 E270G T C missense Het possibly damaging 0.675 phenotype 01/29/2014
14 151967 UTSW Chst9 0.282 R1240 G1 225 N 18 15453174 E111K C T missense Het probably benign 0.000 phenotype 01/29/2014
15 151930 UTSW Cyp3a44 0.290 R1240 G1 225 N 5 145774440 I474L T G missense Het probably benign 0.021 01/29/2014
16 151942 UTSW Dbr1 0.923 R1240 G1 225 N 9 99584020 E550D G T missense Het probably benign 0.439 phenotype 01/29/2014
17 151962 UTSW Dirc2 0.596 R1240 G1 225 N 16 35698009 F445L A G missense Het probably benign 0.001 phenotype 01/29/2014
18 151915 UTSW Dph6 0.234 R1240 G1 225 N 2 114644718 T C splice site 3 bp Het probably null 01/29/2014
19 151917 UTSW Fam227b 0.076 R1240 G1 225 N 2 126124585 I136L T A missense Het possibly damaging 0.563 phenotype 01/29/2014
20 151923 UTSW Fam46b 0.157 R1240 G1 225 N 4 133486504 F229L T C missense Het probably benign 0.007 01/29/2014
21 151936 UTSW Fcgbp 0.243 R1240 G1 225 N 7 28120525 N2559S A G missense Het probably damaging 1.000 01/29/2014
22 151910 UTSW Fh1 1.000 R1240 G1 225 N 1 175604015 I435N A T missense Het probably damaging 0.999 phenotype 01/29/2014
23 151939 UTSW Gab1 1.000 R1240 G1 225 N 8 80788530 S386R A C missense Het probably damaging 0.998 phenotype 01/29/2014
24 151933 UTSW Gkn1 0.020 R1240 G1 225 N 6 87349116 N31Y T A missense Het probably damaging 1.000 phenotype 01/29/2014
25 151968 UTSW Grk2 1.000 R1240 G1 225 N 19 4290679 C251R A G missense Het probably damaging 1.000 phenotype 01/29/2014
26 151964 UTSW H2-DMa 0.277 R1240 G1 225 N 17 34138406 G T critical splice acceptor site Het probably null phenotype 01/29/2014
27 151924 UTSW Hp1bp3 0.503 R1240 G1 225 N 4 138229698 S63P T C missense Het probably damaging 1.000 phenotype 01/29/2014
28 151921 UTSW Ift74 0.455 R1240 G1 225 N 4 94692937 A G splice site Het probably null phenotype 01/29/2014
29 151954 UTSW Inf2 0.169 R1240 G1 225 N 12 112610776 R1018Q G A missense Het unknown phenotype 01/29/2014
30 151965 UTSW Kat2b 0.000 R1240 G1 225 N 17 53624397 D141G A G missense Het probably benign 0.002 phenotype 01/29/2014
31 151908 UTSW Klhl30 0.097 R1240 G1 225 N 1 91361015 S499P T C missense Het probably benign 0.002 01/29/2014
32 151944 UTSW Lama2 0.571 R1240 G1 225 N 10 27041124 D2268E A C missense Het probably damaging 1.000 phenotype 01/29/2014
33 151952 UTSW Lsmem1 0.142 R1240 G1 217 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 01/29/2014
34 151961 UTSW Marf1 0.170 R1240 G1 225 N 16 14146762 N258S T C missense Het possibly damaging 0.478 phenotype 01/29/2014
35 151940 UTSW Mc1r 0.000 R1240 G1 225 N 8 123408260 C251S T A missense Het probably damaging 0.998 phenotype 01/29/2014
36 151950 UTSW Myo15b 0.058 R1240 G1 225 N 11 115880501 Q257K C A missense Het possibly damaging 0.697 01/29/2014
37 151943 UTSW Nbeal2 0.363 R1240 G1 225 N 9 110627108 F2431S A G missense Het probably damaging 0.984 phenotype 01/29/2014
38 151911 UTSW Neb 0.560 R1240 G1 225 N 2 52296309 H917L T A missense Het possibly damaging 0.919 phenotype 01/29/2014
39 151946 UTSW Nlrp1a 0.176 R1240 G1 225 N 11 71113466 A G critical splice donor site 2 bp Het probably null phenotype 01/29/2014
40 151956 UTSW Nr1d2 0.000 R1240 G1 225 N 14 18211891 M404K A T missense Het probably benign 0.038 phenotype 01/29/2014
41 151913 UTSW Olfr32 0.056 R1240 G1 225 N 2 90138813 I109L T G missense Het possibly damaging 0.481 phenotype 01/29/2014
42 151912 UTSW Olfr52 0.403 R1240 G1 225 N 2 86182109 M1L T G start codon destroyed Het possibly damaging 0.942 phenotype 01/29/2014
43 151937 UTSW Otoa 0.000 R1240 G1 225 N 7 121156490 S1040P T C missense Het probably benign 0.000 phenotype 01/29/2014
44 151949 UTSW Pctp 0.062 R1240 G1 122 N 11 90002814 D10G T C missense Het probably benign 0.010 phenotype 01/29/2014
45 151966 UTSW Pja2 0.336 R1240 G1 225 N 17 64309618 T94K G T missense Het probably benign 0.001 01/29/2014
46 151934 UTSW Plxna1 0.812 R1240 G1 143 N 6 89321050 V1749M C T missense Het probably damaging 1.000 phenotype 01/29/2014
47 151963 UTSW Prdm15 0.587 R1240 G1 225 N 16 97837600 E87K C T missense Het probably damaging 0.977 01/29/2014
48 151909 UTSW Rgsl1 0.128 R1240 G1 225 N 1 153785191 F1028L A G missense Het probably benign 0.177 01/29/2014
49 151926 UTSW Sepsecs 0.952 R1240 G1 225 N 5 52660679 N252S T C missense Het probably damaging 1.000 phenotype 01/29/2014
50 151922 UTSW Skint5 0.318 R1240 G1 225 N 4 113717107 L749Q A T missense Het unknown 01/29/2014
51 151958 UTSW Slc22a22 0.033 R1240 G1 225 N 15 57250872 S353F G A missense Het probably benign 0.024 01/29/2014
52 151918 UTSW Slc7a13 0.043 R1240 G1 225 N 4 19819212 K137N A T missense Het probably damaging 1.000 01/29/2014
53 151951 UTSW Snx13 1.000 R1240 G1 225 N 12 35091406 V163L G T missense Het probably damaging 0.991 phenotype 01/29/2014
54 151947 UTSW Synrg 0.552 R1240 G1 225 N 11 84023356 T1115S A T missense Het probably damaging 1.000 phenotype 01/29/2014
55 151938 UTSW Tenm3 0.304 R1240 G1 225 N 8 48287893 V1185A A G missense Het possibly damaging 0.735 phenotype 01/29/2014
56 151959 UTSW Tg 0.153 R1240 G1 225 N 15 66828548 N118K T A missense Het probably benign 0.164 phenotype 01/29/2014
57 151960 UTSW Top1mt 0.000 R1240 G1 225 N 15 75670067 K153E T C missense Het probably damaging 0.985 phenotype 01/29/2014
58 262458 UTSW Trmt11 0.335 R1240 G1 225 N 10 30590825 T C intron Het probably benign 02/04/2015
59 151907 UTSW Unc80 0.921 R1240 G1 225 N 1 66635902 D1953G A G missense Het possibly damaging 0.845 phenotype 01/29/2014
60 151935 UTSW Vmn2r25 0.148 R1240 G1 225 N 6 123851905 S137C T A missense Het probably damaging 0.976 01/29/2014
61 262457 UTSW Vwf 0.249 R1240 G1 177 N 6 125603308 C A intron Het probably null phenotype 02/04/2015
[records 1 to 61 of 61]