Incidental Mutations

24 incidental mutations are currently displayed, and affect 24 genes.
3 are Possibly Damaging.
10 are Probably Damaging.
8 are Probably Benign.
3 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 24 of 24] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 157802 UTSW Alpk3 0.647 R1306 G1 206 N 7 81093873 L1146H T A missense Het probably damaging 0.999 phenotype 02/18/2014
2 157807 UTSW Atad2b 0.000 R1306 G1 225 N 12 4974239 I121M A G missense Het probably benign 0.076 phenotype 02/18/2014
3 157815 UTSW Atg2a 0.410 R1306 G1 225 N 19 6253021 T1053S A T missense Het probably benign 0.313 02/18/2014
4 157796 UTSW Bend5 0.243 R1306 G1 225 N 4 111459773 Q127* C T nonsense Het probably null 02/18/2014
5 157799 UTSW Ccser1 0.161 R1306 G1 181 N 6 62380106 D843N G A missense Het probably damaging 0.991 02/18/2014
6 157795 UTSW Dennd4b 0.555 R1306 G1 225 N 3 90271165 T512A A G missense Het probably benign 0.001 02/18/2014
7 157817 UTSW Dnmbp 0.484 R1306 G1 225 N 19 43901779 D516E A T missense Het probably benign 0.003 phenotype 02/18/2014
8 157809 UTSW Dok3 0.142 R1306 G1 225 N 13 55527448 E86* C A nonsense Het probably null phenotype 02/18/2014
9 157804 UTSW Fat3 0.436 R1306 G1 225 N 9 16376679 I516T A G missense Het probably damaging 0.999 phenotype 02/18/2014
10 262747 UTSW Gabbr1 0.725 R1306 G1 225 N 17 37055990 T A intron 43 bp Het probably null phenotype 02/04/2015
11 157794 UTSW Gjd2 0.304 R1306 G1 225 N 2 114011865 T44A T C missense Het probably damaging 0.969 phenotype 02/18/2014
12 157798 UTSW Mcm7 1.000 R1306 G1 225 N 5 138167203 A480S C A missense Het probably damaging 1.000 phenotype 02/18/2014
13 157808 UTSW Meox2 0.740 R1306 G1 105 N 12 37109031 GCACCACCACCACCACCACCA GCACCACCACCACCACCA small deletion Het probably benign phenotype 02/18/2014
14 157805 UTSW Ntn4 0.000 R1306 G1 225 N 10 93707353 R314W C T missense Het probably damaging 0.988 0.212 phenotype 02/18/2014
15 157813 UTSW Pdzph1 0.094 R1306 G1 225 N 17 58932432 H967R T C missense Het possibly damaging 0.904 02/18/2014
16 157800 UTSW Pik3c2g 0.136 R1306 G1 225 N 6 139772428 N227S A G missense Het probably benign 0.000 phenotype 02/18/2014
17 157812 UTSW Pkd1 1.000 R1306 G1 225 N 17 24573172 S1278P T C missense Het probably damaging 0.970 phenotype 02/18/2014
18 157797 UTSW Plch2 0.000 R1306 G1 225 N 4 155007140 E71G T C missense Het probably damaging 1.000 phenotype 02/18/2014
19 157801 UTSW Pnmal1 0.037 R1306 G1 225 N 7 16962025 R428G A G missense Het probably benign 0.001 02/18/2014
20 157806 UTSW Sertad2 0.416 R1306 G1 146 N 11 20648388 S195P T C missense Het probably benign 0.000 phenotype 02/18/2014
21 157792 UTSW Slc19a3 0.188 R1306 G1 225 N 1 83022762 L178S A G missense Het probably damaging 1.000 phenotype 02/18/2014
22 157816 UTSW Smarca2 0.000 R1306 G1 225 N 19 26770988 D139G A G missense Het possibly damaging 0.813 phenotype 02/18/2014
23 157811 UTSW Tm4sf19 0.073 R1306 G1 225 N 16 32407902 V170M G A missense Het probably damaging 1.000 02/18/2014
24 157803 UTSW Vwa3a 0.165 R1306 G1 225 N 7 120800390 S1031R C G missense Het possibly damaging 0.490 02/18/2014
[records 1 to 24 of 24]