Incidental Mutations

40 incidental mutations are currently displayed, and affect 40 genes.
10 are Possibly Damaging.
10 are Probably Damaging.
14 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 40 of 40] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 159656 UTSW 1810009A15Rik 0.156 R1412 G1 225 Y 19 8889995 T C splice site Het probably benign 0.050 03/14/2014
2 159634 UTSW 9030624J02Rik 0.178 R1412 G1 225 Y 7 118809971 I612F A T missense Het probably damaging 0.994 0.234 03/14/2014
3 159635 UTSW Abca15 0.086 R1412 G1 225 Y 7 120345323 R394C C T missense Het possibly damaging 0.934 0.078 03/14/2014
4 159631 UTSW Adamts9 1.000 R1412 G1 225 Y 6 92796433 Q1152R T C missense Het probably benign 0.000 0.086 phenotype 03/14/2014
5 159646 UTSW Adgrv1 0.000 R1412 G1 225 Y 13 81095450 G6277E C T missense Het probably damaging 1.000 0.116 phenotype 03/14/2014
6 159624 UTSW Agbl2 0.000 R1412 G1 225 Y 2 90788954 N41S A G missense Het probably benign 0.000 0.204 phenotype 03/14/2014
7 159640 UTSW Akap7 0.000 R1412 G1 225 Y 10 25289597 A T critical splice donor site 2 bp Het probably null 0.518 phenotype 03/14/2014
8 159633 UTSW Arl6ip1 0.471 R1412 G1 225 Y 7 118120368 I179T A G missense Het possibly damaging 0.956 0.232 phenotype 03/14/2014
9 159621 UTSW Atp1a4 0.000 R1412 G1 225 Y 1 172232009 D839N C T missense Het probably damaging 0.967 0.288 phenotype 03/14/2014
10 159653 UTSW B3galt4 0.372 R1412 G1 225 Y 17 33950839 R142C G A missense Het probably damaging 1.000 0.346 phenotype 03/14/2014
11 159628 UTSW C1qtnf12 0.162 R1412 G1 225 Y 4 155962733 V52A T C missense Het probably benign 0.000 0.138 03/14/2014
12 159644 UTSW C1qtnf2 0.277 R1412 G1 225 Y 11 43491132 Y257C A G missense Het probably damaging 1.000 0.118 03/14/2014
13 159622 UTSW Cdc123 0.936 R1412 G1 225 Y 2 5803965 D233E A T missense Het possibly damaging 0.798 0.306 03/14/2014
14 159647 UTSW Chdh 0.000 R1412 G1 225 Y 14 30034723 E369K G A missense Het probably benign 0.008 0.228 phenotype 03/14/2014
15 159629 UTSW D630045J12Rik 0.078 R1412 G1 191 Y 6 38195760 V491A A G missense Het probably benign 0.031 0.045 phenotype 03/14/2014
16 159627 UTSW Focad 0.385 R1412 G1 225 Y 4 88278261 T C critical splice donor site 2 bp Het probably null 0.428 03/14/2014
17 159654 UTSW Gabbr1 0.755 R1412 G1 133 Y 17 37054913 T C splice site 6 bp Het probably null 0.644 phenotype 03/14/2014
18 159623 UTSW Hat1 0.677 R1412 G1 225 Y 2 71420617 E170* G T nonsense Het probably null 0.620 phenotype 03/14/2014
19 159641 UTSW Hs3st5 0.269 R1412 G1 225 Y 10 36832676 H69L A T missense Het probably benign 0.021 0.050 phenotype 03/14/2014
20 159626 UTSW Igsf10 0.271 R1412 G1 225 Y 3 59327775 T C splice site Het probably benign 0.165 03/14/2014
21 159645 UTSW Itga2b 0.258 R1412 G1 207 Y 11 102457005 L890Q A T missense Het probably benign 0.003 0.070 phenotype 03/14/2014
22 159632 UTSW Olfr675 0.225 R1412 G1 225 Y 7 105024195 F262L A G missense Het probably damaging 1.000 0.324 phenotype 03/14/2014
23 159638 UTSW Olfr867 0.119 R1412 G1 225 Y 9 20055415 G16A C G missense Het possibly damaging 0.648 0.324 phenotype 03/14/2014
24 159650 UTSW Parp10 0.199 R1412 G1 225 Y 15 76243084 L51P A G missense Het probably damaging 0.993 0.262 phenotype 03/14/2014
25 159642 UTSW Pbld2 0.000 R1412 G1 225 Y 10 63047522 T108A A G missense Het probably damaging 1.000 0.380 03/14/2014
26 159648 UTSW Pdlim2 0.096 R1412 G1 225 Y 14 70174324 A T splice site Het probably benign 0.056 phenotype 03/14/2014
27 159619 UTSW Pikfyve 1.000 R1412 G1 225 Y 1 65202830 V243A T C missense Het possibly damaging 0.636 0.088 phenotype 03/14/2014
28 244135 UTSW Pla2g12b 0.654 R1412 G1 32 Y 10 59403982 G A critical splice donor site 1 bp Het probably null 0.568 phenotype 10/28/2014
29 159625 UTSW Raly 0.000 R1412 G1 225 Y 2 154857395 T40A A G missense Het possibly damaging 0.954 0.170 phenotype 03/14/2014
30 159655 UTSW Rasgrp3 0.000 R1412 G1 225 Y 17 75509827 G T splice site 5 bp Het probably null 0.655 phenotype 03/14/2014
31 159639 UTSW Rbpms2 0.111 R1412 G1 217 Y 9 65651666 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC unclassified Het probably benign 0.070 phenotype 03/14/2014
32 159651 UTSW Smim22 0.068 R1412 G1 225 Y 16 5007785 E11D G C missense Het possibly damaging 0.955 0.116 03/14/2014
33 159643 UTSW Socs2 0.131 R1412 G1 165 Y 10 95414918 S18G T C missense Het probably benign 0.000 0.076 phenotype 03/14/2014
34 159620 UTSW Srgap2 0.000 R1412 G1 225 Y 1 131300413 E720G T C missense Het possibly damaging 0.812 0.118 phenotype 03/14/2014
35 159630 UTSW Tas2r135 0.028 R1412 G1 225 Y 6 42405834 I102M A G missense Het probably benign 0.002 0.154 03/14/2014
36 244136 UTSW Tex19.2 0.197 R1412 G1 78 Y 11 121116935 V229A A G missense Het possibly damaging 0.911 0.062 Tex19.1 causes testis degeneration and male infertility owing to meiotic arrest in the germ cells. [provided by MGI curators] (source: MGI)">phenotype 10/28/2014
37 159652 UTSW Vmn1r234 0.074 R1412 G1 225 Y 17 21229250 I142N T A missense Het probably benign 0.011 0.063 03/14/2014
38 159636 UTSW Vwa3a 0.164 R1412 G1 225 Y 7 120780154 T494I C T missense Het probably damaging 0.998 0.158 03/14/2014
39 159649 UTSW Vwa8 0.290 R1412 G1 225 Y 14 78908230 R116C C T missense Het probably damaging 1.000 0.522 03/14/2014
40 159637 UTSW Zfhx3 0.842 R1412 G1 225 Y 8 108914567 D1166G A G missense Het possibly damaging 0.880 0.068 phenotype 03/14/2014
[records 1 to 40 of 40]