Incidental Mutations

71 incidental mutations are currently displayed, and affect 71 genes.
12 are Possibly Damaging.
30 are Probably Damaging.
19 are Probably Benign.
8 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 71 of 71] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 161275 UTSW 4932438A13Rik 0.845 R1437 G1 225 N 3 36942429 H1097N C A missense Het possibly damaging 0.655 phenotype 03/14/2014
2 161283 UTSW Abcb1b 0.372 R1437 G1 225 N 5 8821436 V330E T A missense Het possibly damaging 0.904 phenotype 03/14/2014
3 161319 UTSW Abcb5 0.263 R1437 G1 225 N 12 118874762 S1022P A G missense Het probably damaging 0.994 phenotype 03/14/2014
4 161297 UTSW Abcc8 0.602 R1437 G1 141 N 7 46179813 I46T A G missense Het probably damaging 1.000 phenotype 03/14/2014
5 161343 UTSW Add3 0.000 R1437 G1 225 N 19 53233678 R275G A G missense Het probably damaging 0.980 phenotype 03/14/2014
6 161314 UTSW Akap1 0.000 R1437 G1 225 N 11 88844751 G362* C A nonsense Het probably null 0.628 phenotype 03/14/2014
7 161264 UTSW Arhgef4 0.238 R1437 G1 225 N 1 34723945 T761A A G missense Het unknown phenotype 03/14/2014
8 161327 UTSW Asap1 0.323 R1437 G1 225 N 15 64120107 L751Q A T missense Het probably damaging 0.960 phenotype 03/14/2014
9 161341 UTSW Atg2a 0.467 R1437 G1 225 N 19 6250616 P741H C A missense Het probably damaging 1.000 03/14/2014
10 161329 UTSW Atxn10 1.000 R1437 G1 225 N 15 85359474 I46T T C missense Het possibly damaging 0.466 phenotype 03/14/2014
11 161291 UTSW BC049715 0.052 R1437 G1 103 N 6 136840092 A110E C A missense Het probably damaging 0.993 03/14/2014
12 161317 UTSW Btbd7 0.351 R1437 G1 225 N 12 102788090 T806S T A missense Het possibly damaging 0.587 03/14/2014
13 161311 UTSW Cdk4 0.661 R1437 G1 225 N 10 127064689 P108H C A missense Het probably damaging 1.000 phenotype 03/14/2014
14 161310 UTSW Cep290 0.928 R1437 G1 225 N 10 100572101 T2391A A G missense Het probably benign 0.001 phenotype 03/14/2014
15 161265 UTSW Col6a3 0.000 R1437 G1 109 N 1 90801376 A1281E G T missense Het probably damaging 0.999 phenotype 03/14/2014
16 161290 UTSW Cpa5 0.213 R1437 G1 210 N 6 30624655 I165F A T missense Het probably damaging 1.000 phenotype 03/14/2014
17 161340 UTSW Ctdp1 0.962 R1437 G1 225 N 18 80450213 Q356K G T missense Het probably benign 0.012 phenotype 03/14/2014
18 161308 UTSW Ddx21 1.000 R1437 G1 225 N 10 62598590 M130T A G missense Het unknown phenotype 03/14/2014
19 161284 UTSW Epha5 0.000 R1437 G1 225 N 5 84233696 D432A T G missense Het probably damaging 1.000 phenotype 03/14/2014
20 161304 UTSW Esr1 0.844 R1437 G1 116 N 10 4712571 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC small deletion Het probably benign phenotype 03/14/2014
21 161342 UTSW Fads2 0.793 R1437 G1 225 N 19 10091829 L77Q A T missense Het probably benign 0.002 phenotype 03/14/2014
22 161339 UTSW Fbn2 0.519 R1437 G1 225 N 18 58053659 H1723Q A T missense Het possibly damaging 0.676 phenotype 03/14/2014
23 161281 UTSW Fbxo42 0.292 R1437 G1 225 N 4 141167854 H43Y C T missense Het probably benign 0.001 phenotype 03/14/2014
24 161288 UTSW Fry 0.576 R1437 G1 225 N 5 150310425 T121A A G missense Het possibly damaging 0.921 03/14/2014
25 161331 UTSW Gpr156 0.456 R1437 G1 225 N 16 37988542 S209A T G missense Het probably damaging 0.987 phenotype 03/14/2014
26 161306 UTSW Hey2 0.621 R1437 G1 225 N 10 30833849 T303A T C missense Het probably benign 0.001 phenotype 03/14/2014
27 161321 UTSW Hivep1 0.490 R1437 G1 225 N 13 42157140 M952K T A missense Het probably benign 0.026 phenotype 03/14/2014
28 161330 UTSW Hrasls 0.032 R1437 G1 225 N 16 29228170 A147E C A missense Het possibly damaging 0.776 03/14/2014
29 161300 UTSW Hydin 0.900 R1437 G1 225 N 8 110581985 Q3968* C T nonsense Het probably null phenotype 03/14/2014
30 161315 UTSW Jup 1.000 R1437 G1 225 N 11 100383576 E96G T C missense Het probably benign 0.063 phenotype 03/14/2014
31 161299 UTSW Kcnn1 0.000 R1437 G1 225 N 8 70844551 I504T A G missense Het probably benign 0.032 phenotype 03/14/2014
32 161295 UTSW Klk1b9 0.063 R1437 G1 225 N 7 43979690 V174A T C missense Het probably damaging 0.995 phenotype 03/14/2014
33 161338 UTSW Lama3 1.000 R1437 G1 225 N 18 12549227 M1083I G C missense Het possibly damaging 0.462 phenotype 03/14/2014
34 161274 UTSW Lcmt2 0.111 R1437 G1 225 N 2 121138896 S569P A G missense Het probably benign 0.060 0.038 phenotype 03/14/2014
35 161336 UTSW Lrfn2 0.000 R1437 G1 155 N 17 49071225 S445P T C missense Het probably damaging 0.974 phenotype 03/14/2014
36 161294 UTSW Lrp3 0.209 R1437 G1 225 N 7 35213170 G31W C A missense Het probably damaging 1.000 03/14/2014
37 161286 UTSW Lrrc8b 0.168 R1437 G1 225 N 5 105481702 L638P T C missense Het probably damaging 1.000 03/14/2014
38 161313 UTSW Mief2 0.487 R1437 G1 225 N 11 60730943 T113M C T missense Het probably benign 0.013 phenotype 03/14/2014
39 161269 UTSW Mrps2 0.842 R1437 G1 225 N 2 28468887 F76S T C missense Het probably damaging 0.999 phenotype 03/14/2014
40 161312 UTSW Naca 0.523 R1437 G1 225 N 10 128042179 A G intron Het probably benign phenotype 03/14/2014
41 161278 UTSW Ndst4 0.131 R1437 G1 225 N 3 125561450 R336S C A missense Het probably damaging 0.966 phenotype 03/14/2014
42 161268 UTSW Nr1i3 0.000 R1437 G1 118 N 1 171217141 CACTCAACACTAC CAC frame shift Het probably null phenotype 03/14/2014
43 161270 UTSW Nr5a1 1.000 R1437 G1 225 N 2 38710673 T29S T A missense Het probably benign 0.000 phenotype 03/14/2014
44 161273 UTSW Olfr1111 0.261 R1437 G1 225 N 2 87149771 V297M C T missense Het possibly damaging 0.937 phenotype 03/14/2014
45 161272 UTSW Olfr993 0.701 R1437 G1 225 N 2 85414874 I2V T C missense Het probably benign 0.012 phenotype 03/14/2014
46 161307 UTSW Pald1 0.386 R1437 G1 225 N 10 61341285 F662S A G missense Het possibly damaging 0.633 03/14/2014
47 161344 UTSW Pdcd4 0.285 R1437 G1 225 N 19 53909243 A59S G T missense Het probably damaging 0.993 phenotype 03/14/2014
48 161301 UTSW Pde4a 0.277 R1437 G1 100 N 9 21192592 T C critical splice donor site 2 bp Het probably null phenotype 03/14/2014
49 161334 UTSW Pkd1 1.000 R1437 G1 206 N 17 24595132 S4159T T A missense Het probably damaging 0.999 phenotype 03/14/2014
50 161276 UTSW Plch1 0.191 R1437 G1 223 N 3 63697533 R1641L C A missense Het probably benign 0.369 phenotype 03/14/2014
51 161328 UTSW Plec 0.885 R1437 G1 225 N 15 76189281 P308Q G T missense Het probably damaging 0.993 phenotype 03/14/2014
52 161296 UTSW Pnkp 0.953 R1437 G1 192 N 7 44860402 S262G A G missense Het possibly damaging 0.872 phenotype 03/14/2014
53 161267 UTSW Pou2f1 1.000 R1437 G1 215 N 1 165891830 V504A A G missense Het probably damaging 0.976 phenotype 03/14/2014
54 161337 UTSW Prepl 0.368 R1437 G1 225 N 17 85088357 R66W G A missense Het probably damaging 0.999 phenotype 03/14/2014
55 161324 UTSW Rasgrf2 0.378 R1437 G1 225 N 13 92030888 K226E T C missense Het probably damaging 0.999 phenotype 03/14/2014
56 161280 UTSW Ror1 1.000 R1437 G1 225 N 4 100412109 F381L T A missense Het probably benign 0.000 phenotype 03/14/2014
57 161292 UTSW Sbsn 0.032 R1437 G1 225 N 7 30753053 Q498* C T nonsense Het probably null 03/14/2014
58 161293 UTSW Scgb2b19 0.028 R1437 G1 225 N 7 33278555 I106V T C missense Het probably benign 0.080 03/14/2014
59 161309 UTSW Sf3a2 0.943 R1437 G1 142 N 10 80804206 G A unclassified Het probably benign 0.196 03/14/2014
60 161277 UTSW Sis 0.000 R1437 G1 225 N 3 72934142 H780R T C missense Het probably damaging 1.000 phenotype 03/14/2014
61 161322 UTSW Slc28a3 0.169 R1437 G1 218 N 13 58558575 C617* G T nonsense Het probably null phenotype 03/14/2014
62 161279 UTSW Slc44a1 0.287 R1437 G1 225 N 4 53561006 V574D T A missense Het probably damaging 1.000 03/14/2014
63 161316 UTSW Slc8a3 0.000 R1437 G1 225 N 12 81315986 T20S T A missense Het probably damaging 0.989 0.084 phenotype 03/14/2014
64 161303 UTSW Stt3b 0.579 R1437 G1 225 N 9 115254927 I394F T A missense Het probably damaging 1.000 phenotype 03/14/2014
65 161302 UTSW Ubap1l 0.100 R1437 G1 185 N 9 65372055 V212D T A missense Het possibly damaging 0.600 03/14/2014
66 161285 UTSW Ugt2b35 0.115 R1437 G1 225 N 5 87001031 V47A T C missense Het probably benign 0.017 03/14/2014
67 161333 UTSW Vmn2r114 0.149 R1437 G1 87 N 17 23291211 F765S A G missense Het probably damaging 1.000 03/14/2014
68 161289 UTSW Vps50 0.574 R1437 G1 225 N 6 3517852 Q97* C T nonsense Het probably null 03/14/2014
69 161287 UTSW Vsig10 0.052 R1437 G1 225 N 5 117351570 Q467R A G missense Het probably damaging 0.957 03/14/2014
70 161271 UTSW Wdsub1 0.122 R1437 G1 151 N 2 59878133 Y11S T G missense Het probably damaging 0.977 03/14/2014
71 161332 UTSW Zbtb11 0.979 R1437 G1 225 N 16 55991620 T G critical splice donor site 2 bp Het probably null 03/14/2014
[records 1 to 71 of 71]