Incidental Mutations

86 incidental mutations are currently displayed, and affect 86 genes.
11 are Possibly Damaging.
41 are Probably Damaging.
24 are Probably Benign.
9 are Probably Null.
6 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 86 of 86] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 163300 UTSW 4930584F24Rik 0.231 R1484 G1 225 Y 5 26479778 A T exon Het noncoding transcript 0.060 03/28/2014
2 163282 UTSW Acvr1 1.000 R1484 G1 225 Y 2 58479889 V36E A T missense Het probably damaging 1.000 0.108 phenotype 03/28/2014
3 163297 UTSW Aldh4a1 0.227 R1484 G1 225 Y 4 139643447 I414V A G missense Het probably benign 0.003 0.106 phenotype 03/28/2014
4 163307 UTSW Alox5 0.214 R1484 G1 225 Y 6 116454167 C100Y C T missense Het probably damaging 1.000 0.570 phenotype 03/28/2014
5 163313 UTSW Ano5 0.151 R1484 G1 225 Y 7 51566320 D348E T A missense Het probably damaging 0.998 0.094 phenotype 03/28/2014
6 163278 UTSW Arhgap30 0.147 R1484 G1 225 Y 1 171403271 V199M G A missense Het probably damaging 1.000 0.030 03/28/2014
7 163351 UTSW Arl13b 1.000 R1484 G1 225 Y 16 62806636 Q234L T A missense Het probably benign 0.000 0.068 phenotype 03/28/2014
8 163344 UTSW Atxn1 0.000 R1484 G1 225 Y 13 45557576 E627* C A nonsense Het probably null 0.620 phenotype 03/28/2014
9 163330 UTSW Bend3 0.566 R1484 G1 225 Y 10 43510201 F197L T C missense Het probably benign 0.000 0.172 03/28/2014
10 163336 UTSW Brca1 1.000 R1484 G1 225 Y 11 101529812 V190E A T missense Het possibly damaging 0.861 0.054 phenotype 03/28/2014
11 163306 UTSW Brpf1 0.972 R1484 G1 225 Y 6 113315135 W381R T C missense Het probably damaging 1.000 0.560 phenotype 03/28/2014
12 163352 UTSW Brwd1 0.000 R1484 G1 225 Y 16 96028291 A C unclassified Het probably null 0.610 phenotype 03/28/2014
13 163309 UTSW C1s2 0.129 R1484 G1 225 Y 6 124625645 I530V T C missense Het possibly damaging 0.952 0.124 03/28/2014
14 163315 UTSW C2cd3 1.000 R1484 G1 225 Y 7 100440190 R1638W C T missense Het probably damaging 1.000 0.220 phenotype 03/28/2014
15 163312 UTSW Capns1 1.000 R1484 G1 115 Y 7 30194086 T A unclassified Het probably benign 0.232 phenotype 03/28/2014
16 163326 UTSW Cd109 0.000 R1484 G1 217 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.156 phenotype 03/28/2014
17 163322 UTSW Cep126 0.068 R1484 G1 225 Y 9 8100553 T660I G A missense Het possibly damaging 0.812 0.056 03/28/2014
18 163323 UTSW Cep295 0.917 R1484 G1 225 Y 9 15334784 I744R A C missense Het probably damaging 0.986 0.074 03/28/2014
19 163333 UTSW Chd3 0.444 R1484 G1 225 Y 11 69359899 E668G T C missense Het probably benign 0.173 0.110 phenotype 03/28/2014
20 163302 UTSW Chek2 0.000 R1484 G1 225 Y 5 110848687 T172A A G missense Het probably damaging 1.000 0.490 phenotype 03/28/2014
21 163327 UTSW Col6a4 0.124 R1484 G1 225 Y 9 106013302 A G critical splice donor site 2 bp Het probably null 03/28/2014
22 163289 UTSW Coq3 0.832 R1484 G1 225 Y 4 21900291 V173I G A missense Het probably benign 0.012 0.044 phenotype 03/28/2014
23 163294 UTSW Cyp4x1 0.132 R1484 G1 225 Y 4 115112901 I343N A T missense Het probably damaging 1.000 0.622 phenotype 03/28/2014
24 163317 UTSW D430042O09Rik 0.242 R1484 G1 225 Y 7 125816571 C A splice site Het probably benign phenotype 03/28/2014
25 163273 UTSW Dnah7b 0.270 R1484 G1 225 Y 1 46137543 D774E T A missense Het probably benign 0.002 0.008 03/28/2014
26 163287 UTSW Ecm1 0.305 R1484 G1 225 Y 3 95735963 R342C G A missense Het probably damaging 0.997 0.398 phenotype 03/28/2014
27 163361 UTSW Esrra 0.000 R1484 G1 225 Y 19 6912829 Y209C T C missense Het probably damaging 0.996 0.122 phenotype 03/28/2014
28 163285 UTSW Gpr149 0.136 R1484 G1 225 Y 3 62595171 D421E A T missense Het probably benign 0.004 0.020 phenotype 03/28/2014
29 163350 UTSW Gpr15 0.000 R1484 G1 225 Y 16 58718574 N51D T C missense Het probably damaging 1.000 0.240 phenotype 03/28/2014
30 163349 UTSW Gpr156 0.478 R1484 G1 225 Y 16 37992196 V298A T C missense Het probably damaging 0.994 0.130 phenotype 03/28/2014
31 163281 UTSW Hmcn2 0.730 R1484 G1 214 Y 2 31346495 G350D G A missense Het probably damaging 1.000 0.052 03/28/2014
32 163283 UTSW Ifih1 0.184 R1484 G1 225 Y 2 62610558 N421K A T missense Het probably benign 0.001 0.088 phenotype 03/28/2014
33 163332 UTSW Ilvbl 0.276 R1484 G1 225 Y 10 78576730 T95K C A missense Het probably damaging 1.000 0.504 phenotype 03/28/2014
34 163337 UTSW Itgb4 1.000 R1484 G1 148 Y 11 115999799 D1104E T A missense Het probably benign 0.014 0.060 phenotype 03/28/2014
35 163362 UTSW Lipf 0.211 R1484 G1 225 Y 19 33964780 M37L A T missense Het probably benign 0.002 0.056 phenotype 03/28/2014
36 163343 UTSW Lyst 0.411 R1484 G1 225 Y 13 13678190 N2258K T A missense Het probably benign 0.008 0.119 phenotype 03/28/2014
37 163328 UTSW Moxd1 0.187 R1484 G1 149 Y 10 24223860 Y86C A G missense Het probably damaging 0.999 0.776 03/28/2014
38 163318 UTSW Muc5ac 0.000 R1484 G1 225 Y 7 141813892 T C splice site 6 bp Het probably null 0.640 phenotype 03/28/2014
39 163319 UTSW Myo16 0.300 R1484 G1 225 Y 8 10560145 R1162H G A missense Het probably damaging 1.000 0.202 phenotype 03/28/2014
40 163325 UTSW Myo5c 0.170 R1484 G1 86 Y 9 75300810 N1609Y A T missense Het probably damaging 1.000 0.456 03/28/2014
41 163274 UTSW Nbeal1 0.438 R1484 G1 225 Y 1 60200939 F155L T C missense Het probably damaging 0.999 0.106 03/28/2014
42 163345 UTSW Nek4 0.351 R1484 G1 225 Y 14 30982333 M602L A T missense Het possibly damaging 0.562 0.168 phenotype 03/28/2014
43 163341 UTSW Nek9 0.586 R1484 G1 225 Y 12 85301848 S971P A G missense Het probably damaging 0.996 0.252 phenotype 03/28/2014
44 163356 UTSW Nfya 1.000 R1484 G1 225 Y 17 48393542 A T unclassified Het probably benign 0.064 phenotype 03/28/2014
45 163342 UTSW Nrxn3 0.000 R1484 G1 225 Y 12 89254777 N442I A T missense Het probably damaging 0.992 0.088 phenotype 03/28/2014
46 163299 UTSW Nupl2 0.592 R1484 G1 225 Y 5 24178077 K200N A C missense Het probably benign 0.079 0.114 03/28/2014
47 163284 UTSW Olfr1216 0.039 R1484 G1 225 N 2 89013369 R232* G A nonsense Het probably null phenotype 03/28/2014
48 163334 UTSW Olfr385 0.065 R1484 G1 225 Y 11 73589361 I126L T A missense Het possibly damaging 0.908 0.064 phenotype 03/28/2014
49 163324 UTSW Olfr850 0.156 R1484 G1 225 Y 9 19478127 T38I G A missense Het probably damaging 1.000 0.210 phenotype 03/28/2014
50 163331 UTSW Pcdh15 0.347 R1484 G1 225 Y 10 74291001 I304N T A missense Het probably damaging 0.999 0.128 phenotype 03/28/2014
51 163291 UTSW Pigo 0.458 R1484 G1 225 Y 4 43024779 P107A G C missense Het probably damaging 0.989 0.174 phenotype 03/28/2014
52 163363 UTSW Plce1 0.394 R1484 G1 225 Y 19 38705339 Q769* C T nonsense Het probably null 0.568 phenotype 03/28/2014
53 163293 UTSW Plin2 0.344 R1484 G1 225 Y 4 86657244 R356H C T missense Het probably benign 0.004 0.030 phenotype 03/28/2014
54 163304 UTSW Ppp1r9a 0.282 R1484 G1 225 Y 6 5113712 E739* G T nonsense Het probably null 0.582 phenotype 03/28/2014
55 163346 UTSW Ppp3cc 0.000 R1484 G1 225 Y 14 70240948 N268K G T missense Het probably damaging 1.000 0.032 phenotype 03/28/2014
56 163275 UTSW Prkag3 0.097 R1484 G1 184 Y 1 74740760 D472V T A missense Het probably damaging 1.000 0.544 phenotype 03/28/2014
57 163295 UTSW Ptch2 0.000 R1484 G1 225 Y 4 117110849 D846V A T missense Het probably damaging 0.967 0.344 phenotype 03/28/2014
58 163339 UTSW Rhob 0.374 R1484 G1 225 Y 12 8499388 M82K A T missense Het probably damaging 0.969 0.124 phenotype 03/28/2014
59 163280 UTSW Rps6kc1 0.326 R1484 G1 225 Y 1 190799475 R777W T A missense Het possibly damaging 0.627 0.039 03/28/2014
60 163358 UTSW Sap130 0.844 R1484 G1 225 Y 18 31711327 V850E T A missense Het probably damaging 0.997 0.358 phenotype 03/28/2014
61 163298 UTSW Sema3a 0.852 R1484 G1 225 Y 5 13473440 N125K T G missense Het probably damaging 1.000 0.590 phenotype 03/28/2014
62 163348 UTSW Sema5a 1.000 R1484 G1 225 Y 15 32460285 D64G A G missense Het probably damaging 0.999 0.071 phenotype 03/28/2014
63 163321 UTSW Sgo2b 0.153 R1484 G1 225 Y 8 63931473 D163V T A missense Het possibly damaging 0.766 0.216 03/28/2014
64 163347 UTSW Slc15a1 0.187 R1484 G1 225 Y 14 121491239 Y31* A T nonsense Het probably null 0.578 phenotype 03/28/2014
65 163357 UTSW Smchd1 0.482 R1484 G1 225 Y 17 71378257 M1392K A T missense Het probably benign 0.312 0.100 phenotype 03/28/2014
66 163329 UTSW Sobp 0.632 R1484 G1 225 Y 10 43160831 N37I T A missense Het probably damaging 0.999 0.130 phenotype 03/28/2014
67 163320 UTSW Spock3 0.000 R1484 G1 225 Y 8 63220705 C142F G T missense Het probably damaging 0.999 0.520 phenotype 03/28/2014
68 163277 UTSW Stx6 0.112 R1484 G1 225 Y 1 155177904 S86R A C missense Het probably benign 0.051 0.112 03/28/2014
69 163311 UTSW Sult2a4 0.271 R1484 G1 225 Y 7 13909801 M280I C A missense Het probably benign 0.000 0.130 phenotype 03/28/2014
70 163314 UTSW Synm 0.230 R1484 G1 225 Y 7 67736332 D527E A T missense Het probably damaging 1.000 0.206 phenotype 03/28/2014
71 163305 UTSW Tax1bp1 0.178 R1484 G1 225 N 6 52733320 R195W C T missense Het probably damaging 0.989 phenotype 03/28/2014
72 163296 UTSW Themis2 0.088 R1484 G1 225 Y 4 132792485 N76K A T missense Het possibly damaging 0.937 0.046 phenotype 03/28/2014
73 163292 UTSW Tmem8b 0.177 R1484 G1 179 Y 4 43690234 T890A A G missense Het probably benign 0.010 0.036 03/28/2014
74 163354 UTSW Traf7 0.536 R1484 G1 225 Y 17 24511811 H366L T A missense Het possibly damaging 0.861 0.064 phenotype 03/28/2014
75 163316 UTSW Trim30c 0.059 R1484 G1 225 Y 7 104383252 V289D A T missense Het probably benign 0.001 0.118 03/28/2014
76 163335 UTSW Tsr1 0.957 R1484 G1 225 Y 11 74902088 D407E T A missense Het probably damaging 0.996 0.088 03/28/2014
77 163290 UTSW Ubap2 0.264 R1484 G1 225 Y 4 41235593 A33E G T missense Het probably damaging 0.999 0.516 phenotype 03/28/2014
78 163338 UTSW Unc13d 0.195 R1484 G1 225 Y 11 116073875 R255L C A missense Het possibly damaging 0.716 0.058 phenotype 03/28/2014
79 163279 UTSW Ush2a 0.491 R1484 G1 225 Y 1 188810337 G3367* G T nonsense Het probably null 0.536 phenotype 03/28/2014
80 163353 UTSW Vmn1r229 0.120 R1484 G1 225 Y 17 20814529 L12P T C missense Het probably damaging 0.998 0.030 03/28/2014
81 163308 UTSW Vmn2r27 0.069 R1484 G1 225 Y 6 124200515 G510V C A missense Het probably damaging 0.963 0.032 03/28/2014
82 163276 UTSW Vps4b 0.527 R1484 G1 225 Y 1 106779982 E257G T C missense Het probably damaging 1.000 0.578 phenotype 03/28/2014
83 163286 UTSW Vps72 0.916 R1484 G1 204 Y 3 95119151 S136P T C missense Het probably damaging 1.000 0.498 phenotype 03/28/2014
84 163359 UTSW Wdr36 1.000 R1484 G1 225 Y 18 32843885 I181T T C missense Het possibly damaging 0.775 0.069 phenotype 03/28/2014
85 163288 UTSW Wdr63 0.092 R1484 G1 225 Y 3 146097241 D65G T C missense Het probably benign 0.021 0.086 03/28/2014
86 163355 UTSW Wfikkn1 0.142 R1484 G1 225 Y 17 25877791 A520T C T missense Het probably benign 0.006 0.174 phenotype 03/28/2014
[records 1 to 86 of 86]