Incidental Mutations

67 incidental mutations are currently displayed, and affect 67 genes.
9 are Possibly Damaging.
31 are Probably Damaging.
20 are Probably Benign.
7 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 67 of 67] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 172168 UTSW 2510039O18Rik 0.183 R1546 G1 209 N 4 147941775 S251P T C missense Het probably damaging 0.973 04/13/2014
2 262841 UTSW 4931409K22Rik 0.158 R1546 G1 115 N 5 24555428 A T utr 5 prime Het probably null 02/04/2015
3 172160 UTSW 4932438A13Rik 0.882 R1546 G1 225 N 3 36870056 V10A T C missense Het possibly damaging 0.638 phenotype 04/13/2014
4 172215 UTSW Aaas 0.551 R1546 G1 136 N 15 102346718 R79L C A missense Het probably benign 0.002 phenotype 04/13/2014
5 172216 UTSW Acap2 0.154 R1546 G1 216 N 16 31104936 E657* C A nonsense Het probably null 04/13/2014
6 172179 UTSW Adgrg5 0.191 R1546 G1 169 N 8 94941630 E441V A T missense Het probably benign 0.273 phenotype 04/13/2014
7 172171 UTSW Alkbh2 0.000 R1546 G1 140 N 5 114124226 E148K C T missense Het probably damaging 0.979 0.268 phenotype 04/13/2014
8 262842 UTSW AY358078 0.128 R1546 G1 116 N 14 51820419 C T intron 48 bp Het probably null 02/04/2015
9 172183 UTSW Bco2 0.184 R1546 G1 225 N 9 50550629 V25A A G missense Het possibly damaging 0.516 phenotype 04/13/2014
10 172151 UTSW Carf 0.000 R1546 G1 225 N 1 60126036 T A critical splice donor site 2 bp Het probably null phenotype 04/13/2014
11 172191 UTSW Ccdc38 0.169 R1546 G1 225 N 10 93565879 I134L A T missense Het probably benign 0.011 04/13/2014
12 172186 UTSW Cgnl1 0.198 R1546 G1 225 N 9 71725815 S85P A G missense Het probably benign 0.000 phenotype 04/13/2014
13 172202 UTSW Ctsl 1.000 R1546 G1 225 N 13 64367879 V126A A G missense Het probably damaging 1.000 phenotype 04/13/2014
14 172205 UTSW Cwc27 0.000 R1546 G1 225 N 13 104802185 S206A A C missense Het probably damaging 1.000 phenotype 04/13/2014
15 172174 UTSW D630045J12Rik 0.077 R1546 G1 225 N 6 38190655 I1004T A G missense Het probably damaging 0.997 phenotype 04/13/2014
16 172173 UTSW Dgki 0.000 R1546 G1 225 N 6 37050203 V401A A G missense Het probably damaging 1.000 phenotype 04/13/2014
17 172185 UTSW Dpp8 0.368 R1546 G1 225 N 9 65063493 H545Y C T missense Het possibly damaging 0.762 phenotype 04/13/2014
18 172181 UTSW Dpy19l1 0.125 R1546 G1 225 N 9 24475384 C205S A T missense Het probably damaging 0.975 04/13/2014
19 172212 UTSW Enpp2 1.000 R1546 G1 225 N 15 54845829 E797K C T missense Het probably benign 0.007 phenotype 04/13/2014
20 172166 UTSW Ephb2 0.605 R1546 G1 134 N 4 136771009 R253H C T missense Het probably damaging 0.988 phenotype 04/13/2014
21 172225 UTSW Esrra 0.000 R1546 G1 221 N 19 6920297 T31A T C missense Het probably benign 0.072 phenotype 04/13/2014
22 172193 UTSW Ewsr1 1.000 R1546 G1 225 N 11 5078574 C A unclassified Het probably benign phenotype 04/13/2014
23 172194 UTSW Flt4 1.000 R1546 G1 225 N 11 49631981 R475L G T missense Het probably benign 0.027 phenotype 04/13/2014
24 172154 UTSW Gm13547 0.291 R1546 G1 225 N 2 29763909 E138G A G missense Het possibly damaging 0.816 04/13/2014
25 172169 UTSW Gm572 0.092 R1546 G1 225 N 4 148666819 R216S A T missense Het possibly damaging 0.711 phenotype 04/13/2014
26 172163 UTSW Hapln2 0.131 R1546 G1 219 N 3 88024097 Y37F T A missense Het probably benign 0.006 phenotype 04/13/2014
27 172207 UTSW Hcn1 0.081 R1546 G1 121 N 13 117975766 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC small insertion Het probably benign phenotype 04/13/2014
28 172213 UTSW Hhla1 0.069 R1546 G1 225 N 15 65933327 A369T C T missense Het probably benign 0.102 04/13/2014
29 172200 UTSW Hist1h2ae R1546 G1 134 N 13 23570945 V55A A G missense Het probably damaging 0.997 phenotype 04/13/2014
30 172184 UTSW Hmg20a 0.236 R1546 G1 225 N 9 56467401 F14I T A missense Het possibly damaging 0.563 04/13/2014
31 172206 UTSW Itga2 0.000 R1546 G1 225 N 13 114849420 S940T A T missense Het possibly damaging 0.630 phenotype 04/13/2014
32 172153 UTSW Kcnt2 0.406 R1546 G1 225 N 1 140431378 N377S A G missense Het probably benign 0.009 phenotype 04/13/2014
33 172162 UTSW Kirrel 1.000 R1546 G1 218 N 3 87089151 M380I C T missense Het probably null 0.461 0.254 phenotype 04/13/2014
34 172155 UTSW Lhx6 0.652 R1546 G1 133 N 2 36091037 S298P A G missense Het probably benign 0.001 phenotype 04/13/2014
35 172156 UTSW Lrp2 1.000 R1546 G1 225 N 2 69502610 G1521D C T missense Het probably damaging 1.000 phenotype 04/13/2014
36 172177 UTSW Mogat2 0.126 R1546 G1 225 N 7 99232559 W57R A G missense Het probably damaging 0.999 phenotype 04/13/2014
37 172226 UTSW Ms4a3 0.064 R1546 G1 225 N 19 11632907 N97S T C missense Het probably benign 0.100 0.064 phenotype 04/13/2014
38 172192 UTSW Myo1a 0.188 R1546 G1 225 N 10 127712624 D380G A G missense Het probably damaging 1.000 phenotype 04/13/2014
39 172195 UTSW Nufip2 0.903 R1546 G1 225 N 11 77691606 D115E T A missense Het probably damaging 0.994 04/13/2014
40 172201 UTSW Ogn 0.219 R1546 G1 225 N 13 49609333 K50N A T missense Het probably benign 0.002 phenotype 04/13/2014
41 172218 UTSW Olfr202 0.052 R1546 G1 225 N 16 59284003 R165G T C missense Het probably damaging 0.997 phenotype 04/13/2014
42 172182 UTSW Olfr250 0.058 R1546 G1 225 N 9 38367548 M1L A T start codon destroyed Het probably benign 0.000 phenotype 04/13/2014
43 172204 UTSW Pde8b 0.213 R1546 G1 225 N 13 95046443 T269I G A missense Het probably damaging 1.000 phenotype 04/13/2014
44 172224 UTSW Ppargc1b 0.270 R1546 G1 166 N 18 61310606 D495E A T missense Het probably damaging 1.000 phenotype 04/13/2014
45 172170 UTSW Prdm16 0.645 R1546 G1 225 N 4 154528660 K103N C A missense Het possibly damaging 0.939 phenotype 04/13/2014
46 172222 UTSW Proc 1.000 R1546 G1 225 N 18 32127410 G221S C T missense Het probably damaging 1.000 phenotype 04/13/2014
47 172208 UTSW Pxk 0.224 R1546 G1 194 N 14 8164091 N561S A G missense Het probably damaging 0.997 phenotype 04/13/2014
48 172199 UTSW Rapgef5 0.346 R1546 G1 225 N 12 117647101 N323S A G missense Het probably benign 0.003 phenotype 04/13/2014
49 172175 UTSW Slc6a13 0.534 R1546 G1 225 N 6 121332374 D281E T G missense Het possibly damaging 0.780 phenotype 04/13/2014
50 172221 UTSW Slc8a1 1.000 R1546 G1 225 N 17 81648247 Y454C T C missense Het probably damaging 1.000 phenotype 04/13/2014
51 172196 UTSW Sntg2 0.061 R1546 G1 225 N 12 30288296 L115F C A missense Het probably damaging 1.000 phenotype 04/13/2014
52 172211 UTSW Spata13 0.381 R1546 G1 207 N 14 60756408 D1103G A G missense Het probably damaging 0.996 phenotype 04/13/2014
53 172189 UTSW Supv3l1 1.000 R1546 G1 225 N 10 62432446 A540V G A missense Het probably benign 0.079 phenotype 04/13/2014
54 172190 UTSW Tet1 0.000 R1546 G1 225 N 10 62812910 D1914E A T missense Het probably damaging 0.996 phenotype 04/13/2014
55 172187 UTSW Tmem30a 0.893 R1546 G1 195 N 9 79771288 *329Q A G makesense Het probably null phenotype 04/13/2014
56 172165 UTSW Tspan5 0.217 R1546 G1 225 N 3 138898341 L162F A T missense Het probably damaging 0.998 phenotype 04/13/2014
57 172157 UTSW Ttn 1.000 R1546 G1 225 N 2 76719052 K31760N T A missense Het probably damaging 1.000 phenotype 04/13/2014
58 172176 UTSW Tyr 0.373 R1546 G1 225 N 7 87437992 D437E A T missense Het probably benign 0.019 phenotype 04/13/2014
59 172167 UTSW Ubr4 1.000 R1546 G1 225 N 4 139416927 L1427* T A nonsense Het probably null phenotype 04/13/2014
60 172188 UTSW Utrn 0.000 R1546 G1 225 N 10 12436364 D616Y C A missense Het probably damaging 1.000 0.430 phenotype 04/13/2014
61 172203 UTSW Vcan 1.000 R1546 G1 225 N 13 89692956 S1490P A G missense Het probably damaging 0.990 phenotype 04/13/2014
62 172209 UTSW Vcl 1.000 R1546 G1 212 N 14 21008950 C545S T A missense Het probably damaging 1.000 phenotype 04/13/2014
63 172161 UTSW Vmn2r4 0.047 R1546 G1 225 N 3 64406888 G224D C T missense Het probably damaging 1.000 04/13/2014
64 172220 UTSW Vmn2r97 0.055 R1546 G1 225 N 17 18947848 V788E T A missense Het probably damaging 1.000 04/13/2014
65 172197 UTSW Vrtn 0.210 R1546 G1 140 N 12 84648508 V11M G A missense Het probably damaging 0.999 04/13/2014
66 172219 UTSW Zbtb21 0.289 R1546 G1 225 N 16 97952027 V380D A T missense Het probably damaging 0.974 04/13/2014
67 172180 UTSW Zcchc14 0.900 R1546 G1 165 N 8 121604263 G A intron Het probably benign 04/13/2014
[records 1 to 67 of 67]