Incidental Mutations

86 incidental mutations are currently displayed, and affect 85 genes.
8 are Possibly Damaging.
39 are Probably Damaging.
28 are Probably Benign.
9 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 86 of 86] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 202713 UTSW Adgrl3 0.000 R1574 G1 225 N 5 81787449 N1276K T A missense Het probably damaging 0.997 phenotype 06/23/2014
2 202737 UTSW Als2cl 0.077 R1574 G1 164 N 9 110884060 E6G A G missense Het probably damaging 0.999 06/23/2014
3 202767 UTSW Ankrd12 0.260 R1574 G1 225 N 17 65986274 D721E A T missense Het probably benign 0.080 phenotype 06/23/2014
4 500341 UTSW Anpep 0.000 R1574 G1 225 N 7 79838407 A G splice site 6 bp Het probably null phenotype 12/01/2017
5 202736 UTSW Apeh 0.177 R1574 G1 225 N 9 108092726 A T splice site Het probably null phenotype 06/23/2014
6 500351 UTSW Apob 0.772 R1574 G1 225 N 12 7990839 I655L A T missense Het possibly damaging 0.511 phenotype 12/01/2017
7 202742 UTSW Atp2b1 1.000 R1574 G1 225 N 10 98996948 L437Q T A missense Het probably damaging 0.999 phenotype 06/23/2014
8 202753 UTSW Cacna2d3 0.000 R1574 G1 225 N 14 29351822 R222S T A missense Het probably damaging 1.000 phenotype 06/23/2014
9 202704 UTSW Cdc25b 0.000 R1574 G1 225 N 2 131191137 T A splice site Het probably benign phenotype 06/23/2014
10 202733 UTSW Cdon 0.364 R1574 G1 225 N 9 35452937 A G splice site Het probably benign phenotype 06/23/2014
11 202699 UTSW Cenpf 0.613 R1574 G1 225 N 1 189652713 D2457N C T missense Het probably damaging 1.000 phenotype 06/23/2014
12 500350 UTSW Cenpo 0.416 R1574 G1 225 N 12 4215433 A T splice site Het probably null phenotype 12/01/2017
13 202727 UTSW Ces2b 0.025 R1574 G1 225 N 8 104835889 A284S G T missense Het probably benign 0.157 06/23/2014
14 202712 UTSW Clock 0.515 R1574 G1 225 N 5 76242832 D311G T C missense Het probably damaging 1.000 phenotype 06/23/2014
15 202760 UTSW Csmd3 0.848 R1574 G1 225 N 15 47695861 T C splice site Het probably null 06/23/2014
16 171015 UTSW D430041D05Rik 0.111 R1574 G1 103 N 2 104221208 GTGATGATGATGATGATGATG GTGATGATGATGATGATG small deletion Het probably benign 04/13/2014
17 500348 UTSW Dbil5 R1574 G1 225 N 11 76218482 M71V A G missense Het probably benign 0.003 12/01/2017
18 202755 UTSW Ddhd1 0.221 R1574 G1 225 N 14 45595547 L864R A C missense Het probably damaging 1.000 phenotype 06/23/2014
19 202728 UTSW Ddx19a 0.941 R1574 G1 225 N 8 110993111 T C splice site Het probably benign 06/23/2014
20 202751 UTSW Dnah11 0.514 R1574 G1 225 N 12 118060317 C1900R A G missense Het probably damaging 1.000 phenotype 06/23/2014
21 500347 UTSW Dnah2 0.513 R1574 G1 225 N 11 69514688 V666A A G missense Het probably benign 0.262 phenotype 12/01/2017
22 202759 UTSW Dnah5 0.806 R1574 G1 225 N 15 28252423 M754K T A missense Het probably benign 0.001 phenotype 06/23/2014
23 500352 UTSW Dnajc15 0.000 R1574 G1 225 N 14 77826414 S145T A T missense Het probably benign 0.001 phenotype 12/01/2017
24 202773 UTSW Drap1 0.321 R1574 G1 225 N 19 5424257 F25S A G missense Het probably damaging 1.000 phenotype 06/23/2014
25 500340 UTSW Fam83e 0.026 R1574 G1 225 N 7 45726711 E283K G A missense Het probably damaging 0.997 12/01/2017
26 202744 UTSW Fbxo48 0.078 R1574 G1 225 N 11 16953368 G T start gained Het probably benign 06/23/2014
27 202757 UTSW Fndc3a 0.396 R1574 G1 225 N 14 72556557 I892N A T missense Het probably damaging 1.000 phenotype 06/23/2014
28 500337 UTSW Gcn1l1 0.938 R1574 G1 225 N 5 115615552 T2321A A G missense Het probably benign 0.000 12/01/2017
29 202732 UTSW Gm1110 0.038 R1574 G1 225 N 9 26881126 G T splice site Het probably benign 06/23/2014
30 202768 UTSW Gm5499 0.247 R1574 G1 225 N 17 87078995 T C exon Het noncoding transcript 06/23/2014
31 202762 UTSW Gmnc 0.097 R1574 G1 225 N 16 26963979 G T splice site Het probably benign phenotype 06/23/2014
32 202769 UTSW Greb1l 0.592 R1574 G1 225 N 18 10554997 D1681G A G missense Het possibly damaging 0.950 06/23/2014
33 202701 UTSW Hc 0.483 R1574 G1 225 N 2 35000765 G A intron Het probably benign phenotype 06/23/2014
34 500331 UTSW Hmcn2 0.730 R1574 G1 170 N 2 31404887 T2563P A C missense Het probably damaging 0.971 12/01/2017
35 500338 UTSW Iqcd 0.063 R1574 G1 225 N 5 120600235 K39N A T missense Het probably damaging 0.977 12/01/2017
36 500342 UTSW Kank2 0.187 R1574 G1 170 N 9 21774575 S668P A G missense Het probably damaging 1.000 phenotype 12/01/2017
37 202705 UTSW Kcng1 0.151 R1574 G1 225 N 2 168269041 N68Y T A missense Het probably damaging 1.000 phenotype 06/23/2014
38 500355 UTSW Kmt5b 1.000 R1574 G1 211 N 19 3786633 T A splice site 6 bp Het probably null phenotype 12/01/2017
39 500346 UTSW Lama2 0.558 R1574 G1 225 N 10 27324754 I533F T A missense Het possibly damaging 0.651 phenotype 12/01/2017
40 202725 UTSW Lcmt1 1.000 R1574 G1 225 N 7 123402908 I132N T A missense Het probably damaging 1.000 phenotype 06/23/2014
41 202718 UTSW Lrmp 0.117 R1574 G1 225 N 6 145158630 T G splice site Het probably benign phenotype 06/23/2014
42 202710 UTSW Mad2l2 1.000 R1574 G1 161 N 4 148142972 G T unclassified Het probably benign phenotype 06/23/2014
43 202726 UTSW Mcph1 0.000 R1574 G1 225 N 8 18801412 I807T T C missense Het probably damaging 0.991 phenotype 06/23/2014
44 500335 UTSW Mdn1 0.969 R1574 G1 225 N 4 32722315 I2366V A G missense Het probably benign 0.000 12/01/2017
45 500345 UTSW Moxd1 0.187 R1574 G1 225 N 10 24300319 W558R T C missense Het probably damaging 1.000 12/01/2017
46 171023 UTSW Mtus2 0.208 R1574 G1 165 N 5 148076552 K52Q A C missense Het probably benign 0.067 04/13/2014
47 202745 UTSW Myh13 0.361 R1574 G1 225 N 11 67362581 T C unclassified Het probably benign 06/23/2014
48 500356 UTSW Myrf 0.756 R1574 G1 98 N 19 10225487 D141G T C missense Het probably damaging 0.999 phenotype 12/01/2017
49 171043 UTSW Naca 0.544 R1574 G1 143 N 10 128040398 G T intron Het probably benign phenotype 04/13/2014
50 202740 UTSW Ncoa7 0.165 R1574 G1 225 N 10 30694101 I249M T C missense Het probably damaging 1.000 06/23/2014
51 202719 UTSW Obox5 0.128 R1574 G1 225 N 7 15758633 V171A T C missense Het probably damaging 0.992 06/23/2014
52 171017 UTSW Olfr1341 0.090 R1574 G1 102 N 4 118709554 I49N T A missense Het probably damaging 0.993 phenotype 04/13/2014
53 202741 UTSW Olfr1352 0.442 R1574 G1 225 N 10 78983986 N32K C A missense Het probably damaging 1.000 phenotype 06/23/2014
54 500353 UTSW Olfr15 0.155 R1574 G1 225 N 16 3839657 I228T T C missense Het probably damaging 0.993 phenotype 12/01/2017
55 500336 UTSW Olfr70 0.048 R1574 G1 225 N 4 43697134 V13D A T missense Het possibly damaging 0.853 phenotype 12/01/2017
56 202743 UTSW Olfr818 0.039 R1574 G1 225 N 10 129945510 L69P A G missense Het probably damaging 0.997 phenotype 06/23/2014
57 202702 UTSW Olfr988 0.083 R1574 G1 225 N 2 85353899 V9E A T missense Het probably damaging 0.966 phenotype 06/23/2014
58 202756 UTSW Parp4 0.370 R1574 G1 225 N 14 56602295 T487A A G missense Het probably damaging 0.980 phenotype 06/23/2014
59 202711 UTSW Pclo 0.000 R1574 G1 225 N 5 14679831 A G unclassified Het probably benign phenotype 06/23/2014
60 202729 UTSW Pcnx2 0.171 R1574 G1 225 N 8 125773930 R1474C G A missense Het probably damaging 1.000 phenotype 06/23/2014
61 171033 UTSW Pkd1l3 0.000 R1574 G1 174 N 8 109614813 I99M A G missense Het unknown phenotype 04/13/2014
62 202754 UTSW Prrxl1 0.537 R1574 G1 225 N 14 32605324 A G splice site Het probably benign phenotype 06/23/2014
63 202763 UTSW Qtrt2 0.161 R1574 G1 225 N 16 43871832 A G unclassified Het probably benign phenotype 06/23/2014
64 171024 UTSW Ruvbl1 0.980 R1574 G1 148 N 6 88479154 V70A T C missense Het probably damaging 1.000 phenotype 04/13/2014
65 202772 UTSW Sart1 0.901 R1574 G1 225 N 19 5380259 P788L G A missense Het probably damaging 1.000 phenotype 06/23/2014
66 202716 UTSW Sdk1 0.169 R1574 G1 225 N 5 141998879 T740A A G missense Het probably benign 0.026 phenotype 06/23/2014
67 202752 UTSW Serpinb1c 0.112 R1574 G1 225 N 13 32888996 D61G T C missense Het possibly damaging 0.886 06/23/2014
68 171045 UTSW Sfi1 0.243 R1574 G1 217 N 11 3146254 TCGC TC frame shift Het probably null 04/13/2014
69 500332 UTSW Slc24a5 0.000 R1574 G1 225 N 2 125080862 G152S G A missense Het probably damaging 0.961 phenotype 12/01/2017
70 500349 UTSW Slc6a4 0.278 R1574 G1 225 N 11 77019196 I426F A T missense Het possibly damaging 0.931 phenotype 12/01/2017
71 171018 UTSW Srsf4 0.318 R1574 G1 86 N 4 131897695 D134E T A missense Het probably damaging 0.998 phenotype 04/13/2014
72 202724 UTSW Stk33 0.081 R1574 G1 225 N 7 109279820 V441I C T missense Het probably benign 0.008 06/23/2014
73 202766 UTSW Sult1c2 0.038 R1574 G1 225 N 17 53836899 A G critical splice donor site 2 bp Het probably null phenotype 06/23/2014
74 500334 UTSW Tdpoz4 0.628 R1574 G1 225 N 3 93796528 V44E T A missense Het probably benign 0.161 12/01/2017
75 171060 UTSW Tdrd6 0.000 R1574 G1 164 N 17 43625624 S1511L G A missense Het probably damaging 0.957 phenotype 04/13/2014
76 500344 UTSW Tmprss13 0.000 R1574 G1 225 N 9 45343231 T432K C A missense Het probably damaging 1.000 phenotype 12/01/2017
77 202765 UTSW Traf7 0.536 R1574 G1 225 N 17 24510553 L428P A G missense Het probably damaging 0.999 phenotype 06/23/2014
78 500333 UTSW Tubb1 0.303 R1574 G1 225 N 2 174457422 I299T T C missense Het probably benign 0.000 phenotype 12/01/2017
79 500339 UTSW Vmn1r158 0.485 R1574 G1 116 N 7 22790347 W146R A T missense Het probably damaging 0.999 12/01/2017
80 171026 UTSW Vmn1r42 0.159 R1574 G1 164 N 6 89845381 G69S C T missense Het probably damaging 0.991 04/13/2014
81 202717 UTSW Vmn1r42 0.159 R1574 G1 225 N 6 89845077 I170T A G missense Het possibly damaging 0.622 06/23/2014
82 202764 UTSW Vmn2r116 0.093 R1574 G1 225 N 17 23387089 H325L A T missense Het probably damaging 0.985 phenotype 06/23/2014
83 500354 UTSW Zfp516 0.230 R1574 G1 225 N 18 82993175 L1111H T A missense Het possibly damaging 0.934 phenotype 12/01/2017
84 202721 UTSW Zfp61 0.046 R1574 G1 225 N 7 24291210 K505N C G missense Het probably damaging 0.981 06/23/2014
85 500343 UTSW Zfp653 0.227 R1574 G1 225 N 9 22057978 E331* C A nonsense Het probably null 12/01/2017
86 202735 UTSW Zfp949 0.046 R1574 G1 225 N 9 88569777 K467* A T nonsense Het probably null phenotype 06/23/2014
[records 1 to 86 of 86]