Incidental Mutations

72 incidental mutations are currently displayed, and affect 72 genes.
11 are Possibly Damaging.
31 are Probably Damaging.
18 are Probably Benign.
10 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 72 of 72] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 174005 UTSW 1110002E22Rik 0.194 R1648 G1 225 Y 3 138069420 N1457D A G missense Het probably benign 0.176 0.054 04/24/2014
2 174038 UTSW Adgb 0.000 R1648 G1 225 Y 10 10395371 F817L A G missense Het probably damaging 0.998 0.134 04/24/2014
3 174045 UTSW Akap6 0.581 R1648 G1 225 Y 12 53142006 K2068* A T nonsense Het probably null 0.626 phenotype 04/24/2014
4 174017 UTSW Alms1 0.000 R1648 G1 225 Y 6 85678402 L3310P T C missense Het probably damaging 0.993 0.076 phenotype 04/24/2014
5 174024 UTSW Ankrd27 0.494 R1648 G1 225 Y 7 35603853 D219E T A missense Het probably benign 0.005 0.152 04/24/2014
6 174026 UTSW Atp10a 0.448 R1648 G1 158 Y 7 58784827 V283A T C missense Het probably damaging 1.000 0.120 p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 04/24/2014
7 174030 UTSW Atp11a 0.442 R1648 G1 225 Y 8 12847495 S270L C T missense Het probably damaging 1.000 0.068 phenotype 04/24/2014
8 174032 UTSW Casp3 1.000 R1648 G1 225 Y 8 46638074 S254P T C missense Het probably benign 0.000 0.126 phenotype 04/24/2014
9 174007 UTSW Cep104 0.450 R1648 G1 225 Y 4 153979096 G A critical splice donor site 1 bp Het probably null 0.470 phenotype 04/24/2014
10 174049 UTSW Cep170b 0.593 R1648 G1 190 Y 12 112736372 T423I C T missense Het probably damaging 1.000 0.042 04/24/2014
11 174067 UTSW Cfap58 0.283 R1648 G1 225 Y 19 47955405 E348G A G missense Het probably benign 0.130 0.080 04/24/2014
12 173999 UTSW Chd6 0.508 R1648 G1 225 Y 2 161042058 L89S A G missense Het probably damaging 1.000 0.202 phenotype 04/24/2014
13 174021 UTSW Cyp2a22 0.181 R1648 G1 225 Y 7 26932368 S488G T C missense Het probably damaging 0.983 0.154 04/24/2014
14 174033 UTSW D130040H23Rik 0.224 R1648 G1 225 Y 8 69302981 H363Q C A missense Het probably benign 0.043 0.119 04/24/2014
15 174043 UTSW Dcaf7 0.956 R1648 G1 225 Y 11 106051802 F192I T A missense Het probably damaging 1.000 0.172 phenotype 04/24/2014
16 174003 UTSW Ddx20 1.000 R1648 G1 225 Y 3 105679188 I614V T C missense Het probably benign 0.077 0.064 phenotype 04/24/2014
17 174041 UTSW Ehbp1 0.700 R1648 G1 225 Y 11 22096000 T558I G A missense Het probably damaging 1.000 0.178 phenotype 04/24/2014
18 174016 UTSW Eif2ak3 0.801 R1648 G1 225 Y 6 70883631 V397D T A missense Het possibly damaging 0.524 0.146 phenotype 04/24/2014
19 174057 UTSW Eif2b5 0.939 R1648 G1 225 Y 16 20502585 V296A T C missense Het possibly damaging 0.768 0.116 phenotype 04/24/2014
20 174037 UTSW Esr1 0.840 R1648 G1 225 N 10 5001260 E546G A G missense Het possibly damaging 0.759 0.474 phenotype 04/24/2014
21 174011 UTSW Fras1 0.000 R1648 G1 225 Y 5 96726613 T A critical splice donor site 2 bp Het probably null 0.428 phenotype 04/24/2014
22 174015 UTSW G930045G22Rik 0.191 R1648 G1 225 Y 6 50846718 T C unclassified Het noncoding transcript 0.060 04/24/2014
23 174042 UTSW Gemin5 0.966 R1648 G1 225 Y 11 58147979 L568* A T nonsense Het probably null 0.643 phenotype 04/24/2014
24 174062 UTSW Gm22697+Rbm27 0.047 R1648 G1 124 Y 18 42301883 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC small deletion Het probably benign 04/24/2014
25 265927 UTSW Gpr155 0.128 R1648 G1 225 Y 2 73364164 T C unclassified Het probably null 0.646 02/05/2015
26 174058 UTSW Has1 0.000 R1648 G1 112 Y 17 17849985 Y225H A G missense Het probably damaging 1.000 0.182 phenotype 04/24/2014
27 174053 UTSW Hk3 0.094 R1648 G1 225 Y 13 55014461 F110S A G missense Het probably damaging 1.000 0.260 phenotype 04/24/2014
28 174052 UTSW Iars 1.000 R1648 G1 225 Y 13 49723002 K848E A G missense Het possibly damaging 0.845 0.304 phenotype 04/24/2014
29 174006 UTSW Kif17 0.149 R1648 G1 225 Y 4 138269895 Y43C A G missense Het probably damaging 1.000 0.584 phenotype 04/24/2014
30 174066 UTSW Kif20b 0.650 R1648 G1 225 Y 19 34936790 T355S A T missense Het possibly damaging 0.653 0.062 phenotype 04/24/2014
31 174055 UTSW Kif21a 0.419 R1648 G1 225 Y 15 90994367 T237A T C missense Het probably damaging 0.998 0.176 phenotype 04/24/2014
32 174048 UTSW Klc1 0.504 R1648 G1 225 Y 12 111776887 L216P T C missense Het probably damaging 1.000 0.230 phenotype 04/24/2014
33 174056 UTSW Krt7 0.000 R1648 G1 123 N 15 101412567 S32R A C missense Het probably damaging 0.998 phenotype 04/24/2014
34 174061 UTSW Lama3 1.000 R1648 G1 225 Y 18 12532199 D2330G A G missense Het possibly damaging 0.897 0.134 phenotype 04/24/2014
35 174010 UTSW Limch1 0.401 R1648 G1 201 Y 5 66999256 S511R T A missense Het probably damaging 0.998 0.068 04/24/2014
36 174025 UTSW Luzp2 0.000 R1648 G1 225 Y 7 55264270 T A splice site Het probably null 0.636 phenotype 04/24/2014
37 174050 UTSW Macc1 0.083 R1648 G1 225 Y 12 119446421 M308T T C missense Het probably benign 0.244 0.030 phenotype 04/24/2014
38 173994 UTSW Mroh9 0.033 R1648 G1 225 Y 1 163046056 E510A T G missense Het probably damaging 1.000 0.162 04/24/2014
39 174012 UTSW Myo1h 0.319 R1648 G1 225 Y 5 114336275 L458F G T missense Het probably damaging 0.997 0.212 04/24/2014
40 174063 UTSW Neto1 0.079 R1648 G1 225 Y 18 86500054 Y528F A T missense Het probably damaging 0.995 0.210 phenotype 04/24/2014
41 174020 UTSW Nlrp9b 0.073 R1648 G1 225 Y 7 20026544 C187S T A missense Het possibly damaging 0.889 0.028 phenotype 04/24/2014
42 173996 UTSW Nup160 0.984 R1648 G1 225 Y 2 90710088 Y854H T C missense Het probably damaging 0.991 0.394 phenotype 04/24/2014
43 174044 UTSW Odc1 1.000 R1648 G1 225 Y 12 17548537 T C splice site Het probably benign 0.060 phenotype 04/24/2014
44 174065 UTSW Olfr1436 0.095 R1648 G1 225 N 19 12298659 I158L T A missense Het probably benign 0.000 phenotype 04/24/2014
45 174028 UTSW Olfr519 0.074 R1648 G1 225 Y 7 108893765 I214T A G missense Het probably damaging 1.000 0.378 phenotype 04/24/2014
46 174027 UTSW Olfr642 0.275 R1648 G1 225 Y 7 104050169 Y62H A G missense Het probably damaging 1.000 0.037 phenotype 04/24/2014
47 173998 UTSW Plcb2 0.000 R1648 G1 225 Y 2 118723780 M64K A T missense Het possibly damaging 0.507 0.270 phenotype 04/24/2014
48 174054 UTSW Plcxd3 0.086 R1648 G1 225 Y 15 4375809 I33F A T missense Het probably benign 0.000 0.210 04/24/2014
49 174001 UTSW Postn 0.000 R1648 G1 225 Y 3 54376101 T534A A G missense Het probably damaging 0.999 0.370 phenotype 04/24/2014
50 174019 UTSW Prkd2 0.000 R1648 G1 225 Y 7 16857807 F588I T A missense Het possibly damaging 0.513 0.404 phenotype 04/24/2014
51 173997 UTSW Prrg4 0.228 R1648 G1 225 Y 2 104832743 A173S C A missense Het probably benign 0.002 0.018 04/24/2014
52 174023 UTSW Rinl 0.225 R1648 G1 203 Y 7 28797632 A519V C T missense Het probably damaging 0.999 0.068 04/24/2014
53 174034 UTSW Rpgrip1l 1.000 R1648 G1 225 Y 8 91252889 V975G A C missense Het probably damaging 0.999 0.152 phenotype 04/24/2014
54 174064 UTSW Rps6ka4 0.778 R1648 G1 225 Y 19 6839362 V118L C A missense Het probably benign 0.150 0.054 phenotype 04/24/2014
55 254695 UTSW Rtkn 0.215 R1648 G1 20 Y 6 83135994 S16P T C missense Het probably damaging 0.998 0.306 phenotype 12/10/2014
56 173993 UTSW Sbspon 0.125 R1648 G1 138 Y 1 15883759 R99L C A missense Het probably damaging 1.000 0.652 04/24/2014
57 174008 UTSW Sdf4 0.121 R1648 G1 225 Y 4 155999429 A119T G A missense Het probably damaging 0.961 0.196 phenotype 04/24/2014
58 174046 UTSW Sgpp1 0.151 R1648 G1 225 Y 12 75716216 H397L T A missense Het possibly damaging 0.941 0.190 phenotype 04/24/2014
59 174039 UTSW Shc2 0.000 R1648 G1 225 Y 10 79626111 M367L T A missense Het probably benign 0.000 0.096 phenotype 04/24/2014
60 174009 UTSW Slc26a5 0.000 R1648 G1 225 Y 5 21813976 K590* T A nonsense Het probably null 0.628 phenotype 04/24/2014
61 173995 UTSW Slc39a12 0.099 R1648 G1 225 Y 2 14451992 V597A T C missense Het probably benign 0.243 0.100 phenotype 04/24/2014
62 174002 UTSW Smcp 0.182 R1648 G1 225 Y 3 92584481 C20S A T missense Het unknown 0.268 phenotype 04/24/2014
63 174060 UTSW Tdrd6 0.000 R1648 G1 225 Y 17 43627109 V1016G A C missense Het possibly damaging 0.488 0.057 phenotype 04/24/2014
64 174013 UTSW Tmem132c 0.291 R1648 G1 225 Y 5 127463056 T A splice site Het probably benign 0.121 04/24/2014
65 174051 UTSW Tmem170b 0.077 R1648 G1 157 Y 13 41606262 Q16L A T missense Het probably null 0.525 0.228 04/24/2014
66 174036 UTSW Tmem30a 0.764 R1648 G1 225 Y 9 79793029 F61S A G missense Het probably damaging 1.000 0.552 phenotype 04/24/2014
67 174029 UTSW Tnfsf13b 0.208 R1648 G1 225 Y 8 10031534 M232T T C missense Het probably damaging 1.000 0.250 phenotype 04/24/2014
68 174047 UTSW Trip11 1.000 R1648 G1 225 Y 12 101884392 K853* T A nonsense Het probably null 0.604 phenotype 04/24/2014
69 174031 UTSW Tusc3 0.570 R1648 G1 225 Y 8 39046567 S64* C A nonsense Het probably null 0.534 phenotype 04/24/2014
70 174059 UTSW Vmn2r111 0.140 R1648 G1 225 Y 17 22569061 D436E A T missense Het probably benign 0.029 0.110 04/24/2014
71 174022 UTSW Zfp607a 0.140 R1648 G1 225 Y 7 27879068 V521A T C missense Het probably benign 0.017 0.274 04/24/2014
72 174000 UTSW Zfp704 0.000 R1648 G1 225 Y 3 9471039 S140R A T missense Het probably damaging 1.000 0.029 phenotype 04/24/2014
[records 1 to 72 of 72]