Incidental Mutations

66 incidental mutations are currently displayed, and affect 65 genes.
12 are Possibly Damaging.
25 are Probably Damaging.
21 are Probably Benign.
7 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 66 of 66] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 186369 UTSW Abhd12 0.443 R1651 G1 225 Y 2 150848421 Q118L T A missense Het probably benign 0.004 0.094 phenotype 05/09/2014
2 186368 UTSW Acss1 0.000 R1651 G1 225 Y 2 150638437 V238D A T missense Het possibly damaging 0.945 0.059 phenotype 05/09/2014
3 186413 UTSW Adgrv1 0.000 R1651 G1 225 Y 13 81487853 I3512M T C missense Het probably benign 0.195 0.104 phenotype 05/09/2014
4 186391 UTSW Arhgap32 0.000 R1651 G1 225 Y 9 32259800 Q1292R A G missense Het probably damaging 0.998 0.182 phenotype 05/09/2014
5 186423 UTSW Caskin1 0.223 R1651 G1 225 Y 17 24502212 R509C C T missense Het possibly damaging 0.823 0.690 05/09/2014
6 186422 UTSW Cd47 0.000 R1651 G1 225 Y 16 49894228 V147A T C missense Het possibly damaging 0.933 0.074 phenotype 05/09/2014
7 186416 UTSW Cdc20b 0.073 R1651 G1 225 Y 13 113078724 Y275* T A nonsense Het probably null 0.660 05/09/2014
8 186384 UTSW Chd4 0.976 R1651 G1 225 Y 6 125123584 D1745G A G missense Het possibly damaging 0.922 0.368 phenotype 05/09/2014
9 186378 UTSW Crmp1 0.392 R1651 G1 225 Y 5 37273439 S250T T A missense Het probably damaging 0.972 0.136 phenotype 05/09/2014
10 186375 UTSW Crybg2 0.768 R1651 G1 225 Y 4 134074825 P1099T C A missense Het possibly damaging 0.844 0.052 05/09/2014
11 186376 UTSW Crybg2 0.768 R1651 G1 225 Y 4 134074903 K1125E A G missense Het probably benign 0.068 0.094 05/09/2014
12 186429 UTSW Csf1r 0.713 R1651 G1 225 Y 18 61110401 I163N T A missense Het possibly damaging 0.642 0.097 phenotype 05/09/2014
13 186409 UTSW Dicer1 1.000 R1651 G1 225 Y 12 104708805 T733A T C missense Het probably damaging 0.997 0.168 phenotype 05/09/2014
14 186395 UTSW Edar 0.494 R1651 G1 225 Y 10 58606053 V339A A G missense Het possibly damaging 0.493 0.116 phenotype 05/09/2014
15 186420 UTSW Efcab6 0.447 R1651 G1 186 Y 15 83870993 I1374T A G missense Het possibly damaging 0.505 0.070 phenotype 05/09/2014
16 186401 UTSW Erbb2 1.000 R1651 G1 212 Y 11 98433457 R757K G A missense Het probably damaging 0.996 0.348 phenotype 05/09/2014
17 186427 UTSW Fam98a 0.570 R1651 G1 225 Y 17 75547715 V33A A G missense Het probably benign 0.155 0.120 05/09/2014
18 186361 UTSW Farp2 0.000 R1651 G1 225 Y 1 93603469 T C critical splice donor site 2 bp Het probably null 0.540 phenotype 05/09/2014
19 186362 UTSW Fcmr 0.000 R1651 G1 168 Y 1 130878251 T315A A G missense Het probably benign 0.000 0.121 phenotype 05/09/2014
20 186399 UTSW Gdf9 0.240 R1651 G1 225 Y 11 53433749 R115Q G A missense Het probably damaging 0.982 0.304 phenotype 05/09/2014
21 186402 UTSW Gm11639 0.197 R1651 G1 225 Y 11 104720666 R445G A G missense Het probably benign 0.026 0.067 05/09/2014
22 186428 UTSW Gm22697+Rbm27 0.047 R1651 G1 217 Y 18 42301883 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC small deletion Het probably benign 05/09/2014
23 186374 UTSW Gm428 R1651 G1 225 N 4 73687384 N344I A T missense Het possibly damaging 0.746 phenotype 05/09/2014
24 186426 UTSW H2-M10.1 0.075 R1651 G1 225 Y 17 36325756 V52A A G missense Het probably damaging 0.999 0.376 05/09/2014
25 186377 UTSW Hspg2 1.000 R1651 G1 225 Y 4 137533437 C1582* T A nonsense Het probably null 0.640 phenotype 05/09/2014
26 186403 UTSW Icam2 0.000 R1651 G1 225 Y 11 106377956 V229M C T missense Het probably damaging 1.000 0.084 phenotype 05/09/2014
27 186373 UTSW Impad1 1.000 R1651 G1 103 Y 4 4792737 F123L A G missense Het probably damaging 0.998 0.682 phenotype 05/09/2014
28 186398 UTSW Itga7 0.667 R1651 G1 225 Y 10 128948824 P735L C T missense Het probably benign 0.011 0.154 phenotype 05/09/2014
29 186389 UTSW Kbtbd3 0.279 R1651 G1 225 Y 9 4330589 P321Q C A missense Het possibly damaging 0.617 0.124 05/09/2014
30 186417 UTSW Kcnma1 0.827 R1651 G1 225 Y 14 23314194 T997S T A missense Het probably damaging 0.999 0.066 phenotype 05/09/2014
31 186425 UTSW Kifc5b 0.500 R1651 G1 225 Y 17 26925530 F541S T C missense Het probably damaging 1.000 0.510 05/09/2014
32 186363 UTSW Klhdc9 0.210 R1651 G1 212 Y 1 171360448 V72L C A missense Het probably benign 0.000 0.137 05/09/2014
33 186421 UTSW Krt84 0.230 R1651 G1 225 Y 15 101525963 S523F G A missense Het possibly damaging 0.954 0.061 phenotype 05/09/2014
34 186382 UTSW Lrrtm4 0.226 R1651 G1 225 Y 6 80022528 T308A A G missense Het probably benign 0.064 0.052 phenotype 05/09/2014
35 186414 UTSW Map1b 1.000 R1651 G1 225 Y 13 99432583 E1210G T C missense Het unknown 0.082 phenotype 05/09/2014
36 186370 UTSW Mocs3 0.809 R1651 G1 122 Y 2 168231569 Y312C A G missense Het probably damaging 0.980 0.420 phenotype 05/09/2014
37 186404 UTSW Mrps7 0.865 R1651 G1 225 Y 11 115604755 E40* G T nonsense Het probably null 0.608 phenotype 05/09/2014
38 186424 UTSW Msln 0.256 R1651 G1 225 Y 17 25753408 H50R T C missense Het probably benign 0.001 0.125 phenotype 05/09/2014
39 186394 UTSW Myb 1.000 R1651 G1 225 Y 10 21126198 F748S A G missense Het probably damaging 1.000 0.268 phenotype 05/09/2014
40 186419 UTSW Myo10 0.000 R1651 G1 191 Y 15 25742369 H590N C A missense Het probably damaging 0.996 0.216 phenotype 05/09/2014
41 186415 UTSW Naip5 0.071 R1651 G1 225 Y 13 100221911 E939G T C missense Het probably benign 0.415 0.120 phenotype 05/09/2014
42 186359 UTSW Nbeal1 0.438 R1651 G1 225 Y 1 60200119 V107E T A missense Het probably damaging 1.000 0.260 05/09/2014
43 186406 UTSW Nrcam 0.000 R1651 G1 225 Y 12 44576679 N1011I A T missense Het probably damaging 0.971 0.246 phenotype 05/09/2014
44 186367 UTSW Olfr1223 0.046 R1651 G1 225 Y 2 89145002 V7G A C missense Het probably damaging 0.996 0.286 phenotype 05/09/2014
45 186387 UTSW Olfr301 0.241 R1651 G1 225 Y 7 86407870 A G utr 5 prime Het probably benign 0.064 phenotype 05/09/2014
46 186365 UTSW Olfr356 0.082 R1651 G1 225 Y 2 36937323 L68P T C missense Het probably damaging 0.994 0.066 phenotype 05/09/2014
47 186431 UTSW Pcgf6 0.311 R1651 G1 225 Y 19 47049002 C153S A T missense Het probably damaging 1.000 0.678 phenotype 05/09/2014
48 186388 UTSW Phrf1 0.139 R1651 G1 225 Y 7 141237521 V81A T C missense Het probably benign 0.000 0.064 05/09/2014
49 186408 UTSW Ppp4r4 0.119 R1651 G1 225 Y 12 103584072 N36D A G missense Het probably benign 0.007 0.115 phenotype 05/09/2014
50 186407 UTSW Prkch 0.000 R1651 G1 225 Y 12 73759001 T517A A G missense Het possibly damaging 0.880 0.336 phenotype 05/09/2014
51 186380 UTSW Rasal1 0.077 R1651 G1 225 Y 5 120652845 K33* A T nonsense Het probably null 0.582 phenotype 05/09/2014
52 186418 UTSW Rp1l1 0.165 R1651 G1 225 Y 14 64030993 E1343K G A missense Het probably damaging 0.967 0.032 phenotype 05/09/2014
53 186412 UTSW Serpinb6e 0.086 R1651 G1 225 Y 13 33836423 D234G T C missense Het probably benign 0.004 0.131 05/09/2014
54 186393 UTSW Setd2 1.000 R1651 G1 225 Y 9 110549864 S632G A G missense Het probably benign 0.115 0.072 phenotype 05/09/2014
55 186364 UTSW Smyd3 0.204 R1651 G1 225 Y 1 179043876 I313L T G missense Het probably benign 0.000 0.016 phenotype 05/09/2014
56 186411 UTSW Tdrd9 0.380 R1651 G1 225 Y 12 112024706 D543E C A missense Het probably damaging 0.971 0.206 phenotype 05/09/2014
57 186396 UTSW Tet1 0.000 R1651 G1 225 Y 10 62879674 L114P A G missense Het probably damaging 1.000 0.192 phenotype 05/09/2014
58 186379 UTSW Tmprss11c 0.100 R1651 G1 225 Y 5 86239424 P212S G A missense Het probably damaging 0.996 0.032 05/09/2014
59 186366 UTSW Tmx2 0.389 R1651 G1 225 Y 2 84676117 M77K A T missense Het probably damaging 0.993 0.402 phenotype 05/09/2014
60 186410 UTSW Traf3 1.000 R1651 G1 225 Y 12 111262036 D560E T G missense Het probably damaging 0.999 0.356 phenotype 05/09/2014
61 186405 UTSW Trappc12 0.433 R1651 G1 225 Y 12 28691777 M711I C T missense Het probably benign 0.325 0.080 05/09/2014
62 186371 UTSW Trim2 0.541 R1651 G1 225 N 3 84167650 A G critical splice donor site 2 bp Het probably null phenotype 05/09/2014
63 186381 UTSW Vmn2r18 0.162 R1651 G1 225 Y 5 151561999 S677P A G missense Het probably damaging 1.000 0.025 05/09/2014
64 186430 UTSW Wdr7 0.959 R1651 G1 225 Y 18 63720776 L60* T A nonsense Het probably null 0.498 phenotype 05/09/2014
65 186386 UTSW Wdr93 0.195 R1651 G1 225 Y 7 79750082 F140L T C missense Het probably benign 0.001 0.106 05/09/2014
66 186383 UTSW Zfp638 0.536 R1651 G1 225 Y 6 83954737 T802A A G missense Het probably benign 0.002 0.054 phenotype 05/09/2014
[records 1 to 66 of 66]