Incidental Mutations

77 incidental mutations are currently displayed, and affect 77 genes.
10 are Possibly Damaging.
26 are Probably Damaging.
28 are Probably Benign.
12 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 186828 UTSW 5730409E04Rik 0.135 R1662 G1 138 N 4 126611682 M1K T A start codon destroyed Het probably null 0.995 05/09/2014
2 186869 UTSW 5730507C01Rik 0.243 R1662 G1 105 N 12 18531966 R119S A C missense Het possibly damaging 0.533 05/09/2014
3 186827 UTSW Abca1 1.000 R1662 G1 225 N 4 53090251 T A splice site 3 bp Het probably null phenotype 05/09/2014
4 186831 UTSW Aff1 0.323 R1662 G1 225 N 5 103841057 G830D G A missense Het probably damaging 0.991 phenotype 05/09/2014
5 186843 UTSW AI987944 0.122 R1662 G1 225 N 7 41374449 T369A T C missense Het possibly damaging 0.790 05/09/2014
6 261733 UTSW Aoah 0.000 R1662 G1 225 N 13 21000113 A G intron 43 bp Het probably null phenotype 01/28/2015
7 186818 UTSW Arhgap40 0.462 R1662 G1 225 N 2 158539270 C349W C G missense Het probably damaging 1.000 05/09/2014
8 186803 UTSW Atic 0.965 R1662 G1 225 N 1 71576127 D438E T A missense Het probably benign 0.063 phenotype 05/09/2014
9 186834 UTSW Barhl2 1.000 R1662 G1 214 N 5 106453499 M338K A T missense Het probably benign 0.024 phenotype 05/09/2014
10 186876 UTSW Btd 0.147 R1662 G1 225 N 14 31666790 V156A T C missense Het probably damaging 1.000 phenotype 05/09/2014
11 186855 UTSW Ccdc82 0.093 R1662 G1 225 N 9 13262772 V319A T C missense Het probably damaging 0.998 05/09/2014
12 186881 UTSW Celsr1 0.766 R1662 G1 225 N 15 86031062 N903K G T missense Het probably damaging 1.000 phenotype 05/09/2014
13 186810 UTSW Cenpf 0.547 R1662 G1 225 N 1 189657771 N1288I T A missense Het probably damaging 0.985 phenotype 05/09/2014
14 186816 UTSW Ciao1 0.958 R1662 G1 225 N 2 127244937 T252I G A missense Het probably benign 0.012 05/09/2014
15 186878 UTSW Cma2 0.055 R1662 G1 225 N 14 55973116 C87R T C missense Het probably damaging 1.000 05/09/2014
16 186840 UTSW Cops7a 0.000 R1662 G1 225 N 6 124962438 R83W T A missense Het probably damaging 0.958 phenotype 05/09/2014
17 186861 UTSW Cxcr6 0.000 R1662 G1 225 N 9 123810548 M205L A T missense Het possibly damaging 0.710 phenotype 05/09/2014
18 186888 UTSW Dcc 1.000 R1662 G1 225 N 18 71420338 L749P A G missense Het probably benign 0.001 phenotype 05/09/2014
19 186813 UTSW Dync1i2 0.966 R1662 G1 225 N 2 71250979 T484I C T missense Het possibly damaging 0.874 phenotype 05/09/2014
20 186887 UTSW Epas1 1.000 R1662 G1 225 N 17 86829027 K742N A T missense Het probably damaging 0.987 phenotype 05/09/2014
21 186829 UTSW Evc2 1.000 R1662 G1 225 N 5 37348750 T138A A G missense Het probably benign 0.001 phenotype 05/09/2014
22 186808 UTSW F5 1.000 R1662 G1 225 N 1 164207888 I1877T T C missense Het probably damaging 0.999 phenotype 05/09/2014
23 186850 UTSW Fat1 1.000 R1662 G1 225 N 8 44953164 V984G T G missense Het probably benign 0.196 phenotype 05/09/2014
24 186819 UTSW Fat4 1.000 R1662 G1 225 N 3 38980779 V2860D T A missense Het probably damaging 1.000 phenotype 05/09/2014
25 186835 UTSW Foxn4 1.000 R1662 G1 225 N 5 114256894 R324Q C T missense Het probably benign 0.000 phenotype 05/09/2014
26 186842 UTSW Gapdhs 0.155 R1662 G1 225 N 7 30737002 R120H C T missense Het probably damaging 1.000 phenotype 05/09/2014
27 186859 UTSW Gcnt3 0.000 R1662 G1 225 N 9 70034377 D303G T C missense Het probably benign 0.005 phenotype 05/09/2014
28 186809 UTSW Gm16432 0.060 R1662 G1 225 N 1 178046986 K140E A G missense Het unknown 05/09/2014
29 186838 UTSW Gng11 0.090 R1662 G1 225 N 6 4008066 Y43F A T missense Het probably benign 0.134 phenotype 05/09/2014
30 186836 UTSW Hectd4 0.900 R1662 G1 225 N 5 121317245 M651L A C missense Het probably benign 0.014 05/09/2014
31 186883 UTSW Ifngr2 0.000 R1662 G1 225 N 16 91560596 Y200N T A missense Het probably benign 0.011 phenotype 05/09/2014
32 186824 UTSW Iqgap3 0.344 R1662 G1 225 N 3 88098401 V512A T C missense Het probably benign 0.326 05/09/2014
33 186889 UTSW Kdm2a 0.968 R1662 G1 225 N 19 4328212 D187E A C missense Het probably damaging 1.000 phenotype 05/09/2014
34 186832 UTSW Klhl8 0.000 R1662 G1 225 N 5 103872045 V370A A G missense Het probably damaging 0.962 05/09/2014
35 186857 UTSW Kmt2a 1.000 R1662 G1 225 N 9 44836670 G A utr 3 prime Het probably benign phenotype 05/09/2014
36 186867 UTSW Krt12 0.169 R1662 G1 225 N 11 99420824 V184F C A missense Het probably benign 0.422 phenotype 05/09/2014
37 186833 UTSW Lrrc8c 0.000 R1662 G1 225 N 5 105606757 I133F A T missense Het probably benign 0.224 phenotype 05/09/2014
38 186870 UTSW Lsmem1 0.086 R1662 G1 201 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 05/09/2014
39 186815 UTSW Map1a 0.337 R1662 G1 225 N 2 121306408 S2568R C G missense Het possibly damaging 0.903 phenotype 05/09/2014
40 186822 UTSW Mbnl1 0.953 R1662 G1 225 N 3 60625172 Q301K C A missense Het probably damaging 0.999 phenotype 05/09/2014
41 186821 UTSW Med12l 0.400 R1662 G1 225 N 3 59093617 K724N A T missense Het probably damaging 1.000 phenotype 05/09/2014
42 186804 UTSW Mroh2a 0.941 R1662 G1 94 N 1 88241618 I672L A C missense Het probably benign 0.073 0.004 phenotype 05/09/2014
43 186807 UTSW Mybph 0.091 R1662 G1 150 N 1 134193636 P45S C T missense Het probably benign 0.010 05/09/2014
44 186866 UTSW Myo15 0.000 R1662 G1 212 N 11 60501701 S2157T T A missense Het probably damaging 0.998 phenotype 05/09/2014
45 186886 UTSW Olfr113 0.101 R1662 G1 225 N 17 37575273 T50K G T missense Het probably damaging 0.999 phenotype 05/09/2014
46 186882 UTSW Olfr193 0.064 R1662 G1 225 N 16 59110604 E2G T C missense Het probably benign 0.001 phenotype 05/09/2014
47 186853 UTSW Olfr374 0.064 R1662 G1 225 N 8 72109779 V71A T C missense Het probably benign 0.090 phenotype 05/09/2014
48 186874 UTSW Olfr721-ps1 0.071 R1662 G1 225 N 14 14407880 Y217* T A nonsense Het probably null 05/09/2014
49 186863 UTSW Otogl 0.000 R1662 G1 225 N 10 107798357 I1419T A G missense Het possibly damaging 0.842 phenotype 05/09/2014
50 186890 UTSW Ovol1 0.721 R1662 G1 225 N 19 5551639 F118L A T missense Het probably damaging 0.984 phenotype 05/09/2014
51 186817 UTSW Pak7 0.000 R1662 G1 225 N 2 136116760 D136G T C missense Het probably damaging 0.963 phenotype 05/09/2014
52 186851 UTSW Pik3r2 0.000 R1662 G1 225 N 8 70770606 Y417C T C missense Het probably damaging 1.000 phenotype 05/09/2014
53 186880 UTSW Ppp2r2a 1.000 R1662 G1 225 N 14 67016603 N372S T C missense Het probably benign 0.000 phenotype 05/09/2014
54 186885 UTSW Prss30 0.055 R1662 G1 225 N 17 23972832 N238K G T missense Het possibly damaging 0.681 05/09/2014
55 186884 UTSW Prss33 0.069 R1662 G1 149 N 17 23834811 C A unclassified 1974 bp Het probably null 05/09/2014
56 186805 UTSW Ptpn4 0.218 R1662 G1 225 N 1 119765058 E187G T C missense Het probably damaging 0.963 phenotype 05/09/2014
57 186873 UTSW Ptprg 0.000 R1662 G1 225 N 14 12207357 N100I A T missense Het probably damaging 1.000 phenotype 05/09/2014
58 186858 UTSW Rbpms2 0.000 R1662 G1 225 N 9 65651042 V130A T C missense Het probably benign 0.047 phenotype 05/09/2014
59 186865 UTSW Rdh7 0.096 R1662 G1 225 N 10 127888612 M1K A T start codon destroyed Het probably null 1.000 05/09/2014
60 186860 UTSW Rtp3 0.052 R1662 G1 170 N 9 110986683 S205A A C missense Het probably benign 0.235 05/09/2014
61 186814 UTSW Ryr3 0.447 R1662 G1 225 N 2 112709273 D3207E G T missense Het probably damaging 0.988 phenotype 05/09/2014
62 186811 UTSW Scn9a 1.000 R1662 G1 225 N 2 66483459 T1972S T A missense Het probably benign 0.001 phenotype 05/09/2014
63 186846 UTSW Scnn1b 1.000 R1662 G1 225 N 7 121902328 V122A T C missense Het probably benign 0.004 phenotype 05/09/2014
64 186837 UTSW Slc15a4 0.078 R1662 G1 225 N 5 127608979 L213S A G missense Het probably damaging 1.000 phenotype 05/09/2014
65 186841 UTSW Slc27a5 0.229 R1662 G1 225 N 7 12991246 I425F T A missense Het probably damaging 1.000 phenotype 05/09/2014
66 186871 UTSW Spata31d1b 0.106 R1662 G1 225 N 13 59716628 D530G A G missense Het probably benign 0.002 05/09/2014
67 186854 UTSW Tcf25 0.000 R1662 G1 225 N 8 123381550 S115T T A missense Het probably benign 0.002 phenotype 05/09/2014
68 186826 UTSW Tet2 1.000 R1662 G1 225 N 3 133466852 L1883P A G missense Het possibly damaging 0.956 phenotype 05/09/2014
69 186845 UTSW Trim21 0.000 R1662 G1 225 N 7 102561898 R205* T A nonsense Het probably null phenotype 05/09/2014
70 186844 UTSW Ttc23 0.075 R1662 G1 225 N 7 67725321 G T splice site 5 bp Het probably null 05/09/2014
71 186868 UTSW Unc13d 0.200 R1662 G1 154 N 11 116068673 K658R T C missense Het probably null 0.999 phenotype 05/09/2014
72 186839 UTSW Vmn1r43 0.050 R1662 G1 225 N 6 89869590 F305L A G missense Het possibly damaging 0.759 05/09/2014
73 186823 UTSW Vmn2r2 0.087 R1662 G1 225 N 3 64117130 C677S A T missense Het probably benign 0.003 05/09/2014
74 186875 UTSW Wnt5a 1.000 R1662 G1 202 N 14 28518343 M150T T C missense Het probably benign 0.022 phenotype 05/09/2014
75 186830 UTSW Ythdc1 0.970 R1662 G1 225 N 5 86828122 G A critical splice donor site 1 bp Het probably null 05/09/2014
76 186872 UTSW Zcchc6 0.707 R1662 G1 225 N 13 59799903 E466G T C missense Het possibly damaging 0.934 05/09/2014
77 186802 UTSW Zdbf2 0.140 R1662 G1 225 N 1 63304249 R596* A T nonsense Het probably null phenotype 05/09/2014
[records 1 to 77 of 77]