Incidental Mutations

86 incidental mutations are currently displayed, and affect 82 genes.
14 are Possibly Damaging.
28 are Probably Damaging.
30 are Probably Benign.
10 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 86 of 86] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 191157 UTSW 3632451O06Rik 0.090 R1717 G1 225 Y 14 49751664 D616G T C missense Het probably damaging 0.991 0.050 05/14/2014
2 191138 UTSW 4732465J04Rik 0.256 R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Het probably null 05/14/2014
3 191170 UTSW 4930583I09Rik 0.033 R1717 G1 225 Y 17 64834449 N53S T C missense Het unknown 0.062 05/14/2014
4 191096 UTSW 4933434E20Rik 0.206 R1717 G1 225 Y 3 90056237 S67T T A missense Het probably benign 0.233 0.384 05/14/2014
5 191136 UTSW 9230019H11Rik 0.274 R1717 G1 225 Y 10 3125050 A T unclassified Het noncoding transcript 0.088 05/14/2014
6 191114 UTSW Abcc8 0.540 R1717 G1 225 Y 7 46115815 I1127V T C missense Het possibly damaging 0.906 0.310 phenotype 05/14/2014
7 191104 UTSW Abcg3 0.096 R1717 G1 225 Y 5 104963555 Q349* G A nonsense Het probably null 0.634 phenotype 05/14/2014
8 191159 UTSW Adam2 0.000 R1717 G1 225 Y 14 66068558 L158P A G missense Het probably damaging 0.999 0.029 phenotype 05/14/2014
9 191101 UTSW Agrn 0.656 R1717 G1 217 Y 4 156166519 GCTCT GCTCTCT frame shift Het probably null 0.626 phenotype 05/14/2014
10 191126 UTSW Agrp 0.000 R1717 G1 225 Y 8 105566835 T106K G T missense Het probably damaging 1.000 0.458 phenotype 05/14/2014
11 191160 UTSW Akap11 0.000 R1717 G1 225 Y 14 78513348 S533I C A missense Het probably benign 0.022 0.066 phenotype 05/14/2014
12 191131 UTSW Aldh1a2 1.000 R1717 G1 225 Y 9 71293671 N517I A T missense Het probably damaging 0.993 0.170 phenotype 05/14/2014
13 191100 UTSW Aldh4a1 0.222 R1717 G1 225 Y 4 139638529 H277L A T missense Het possibly damaging 0.929 0.310 phenotype 05/14/2014
14 258039 UTSW Aldh4a1 0.222 R1717 G1 66 Y 4 139633994 G A splice site 5 bp Het probably null 0.632 phenotype 01/22/2015
15 191113 UTSW Ankrd27 0.499 R1717 G1 225 Y 7 35628446 D742G A G missense Het probably damaging 0.977 0.206 05/14/2014
16 191116 UTSW Anpep 0.000 R1717 G1 225 Y 7 79838256 E518K C T missense Het probably benign 0.006 0.053 phenotype 05/14/2014
17 191120 UTSW Arhgef7 0.806 R1717 G1 225 Y 8 11808712 C A unclassified Het probably benign phenotype 05/14/2014
18 191121 UTSW Arhgef7 0.806 R1717 G1 225 Y 8 11808713 C A splice site Het probably null 0.610 phenotype 05/14/2014
19 191163 UTSW Arvcf 0.000 R1717 G1 225 Y 16 18401569 K568E A G missense Het possibly damaging 0.524 0.058 phenotype 05/14/2014
20 191137 UTSW Atp8b3 0.175 R1717 G1 225 Y 10 80528797 R521W G A missense Het probably damaging 1.000 0.027 phenotype 05/14/2014
21 191168 UTSW Casp16-ps 0.092 R1717 G1 225 Y 17 23552050 I127T A G missense Het possibly damaging 0.931 0.021 05/14/2014
22 191109 UTSW Cd163 0.000 R1717 G1 225 Y 6 124329588 A G utr 3 prime Het probably benign phenotype 05/14/2014
23 191125 UTSW Cdh8 0.000 R1717 G1 225 Y 8 99030705 S754T A T missense Het probably damaging 1.000 0.252 phenotype 05/14/2014
24 191084 UTSW Cel 0.202 R1717 G1 225 Y 2 28556777 Y461H A G missense Het probably damaging 1.000 0.184 phenotype 05/14/2014
25 191094 UTSW Chmp4b 1.000 R1717 G1 225 Y 2 154657320 I47V A G missense Het possibly damaging 0.622 0.078 phenotype 05/14/2014
26 191148 UTSW Col1a1 1.000 R1717 G1 225 Y 11 94948392 M989V A G missense Het unknown 0.074 phenotype 05/14/2014
27 191161 UTSW Cpsf1 0.983 R1717 G1 225 Y 15 76602566 S257T A T missense Het possibly damaging 0.766 0.148 phenotype 05/14/2014
28 191122 UTSW Csmd1 0.290 R1717 G1 225 Y 8 17216692 S73T A T missense Het possibly damaging 0.578 0.060 phenotype 05/14/2014
29 265934 UTSW Csnk2a2 0.476 R1717 G1 136 N 8 95455808 T C intron 50 bp Het probably null phenotype 02/05/2015
30 191167 UTSW Dact2 0.000 R1717 G1 225 Y 17 14197913 W177R A T missense Het probably benign 0.109 0.126 phenotype 05/14/2014
31 191130 UTSW Ddx10 0.938 R1717 G1 225 Y 9 53159953 V680A A G missense Het probably benign 0.248 0.060 phenotype 05/14/2014
32 191152 UTSW Eif5 0.979 R1717 G1 225 Y 12 111542217 D215E T A missense Het probably benign 0.004 0.044 phenotype 05/14/2014
33 191149 UTSW Evpl 0.000 R1717 G1 225 Y 11 116225492 A817T C T missense Het probably benign 0.056 0.056 phenotype 05/14/2014
34 191083 UTSW Fmo6 0.123 R1717 G1 225 Y 1 162926252 R131* T A nonsense Het probably null 0.634 05/14/2014
35 191117 UTSW Fsd2 0.078 R1717 G1 225 Y 7 81535109 T680A T C missense Het probably benign 0.230 0.128 phenotype 05/14/2014
36 191089 UTSW Fsip2 0.271 R1717 G1 225 Y 2 82974945 V536A T C missense Het possibly damaging 0.678 0.068 phenotype 05/14/2014
37 191171 UTSW Fzd8 0.000 R1717 G1 225 Y 18 9214364 F482S T C missense Het probably damaging 1.000 0.646 phenotype 05/14/2014
38 226073 UTSW Gabrb1 0.072 R1717 G1 225 N 5 72108351 A T synonymous Het probably null phenotype 09/11/2014
39 191105 UTSW Galnt9 0.145 R1717 G1 225 Y 5 110596212 I304S T G missense Het probably benign 0.010 0.060 phenotype 05/14/2014
40 191123 UTSW Glra3 0.000 R1717 G1 225 Y 8 55940907 A18S G T missense Het probably benign 0.068 0.070 phenotype 05/14/2014
41 191115 UTSW Gm5334 0.442 R1717 G1 225 Y 7 68618977 A C exon Het noncoding transcript 05/14/2014
42 191110 UTSW Grcc10 0.303 R1717 G1 217 Y 6 124740513 A T unclassified Het probably benign phenotype 05/14/2014
43 191082 UTSW Hmcn1 0.274 R1717 G1 225 Y 1 150859186 T192A T C missense Het probably damaging 0.999 0.146 phenotype 05/14/2014
44 191133 UTSW Ip6k1 0.205 R1717 G1 225 Y 9 108040996 E77K G A missense Het possibly damaging 0.889 0.310 phenotype 05/14/2014
45 191145 UTSW Irgm2 0.092 R1717 G1 225 Y 11 58220635 L396Q T A missense Het probably damaging 1.000 0.047 phenotype 05/14/2014
46 314419 UTSW Ksr2 0.261 R1717 G1 225 Y 5 117671449 C426S T A missense Het probably damaging 0.994 0.890 phenotype 05/04/2015
47 191111 UTSW Lair1 0.000 R1717 G1 225 Y 7 4010789 F153S A G missense Het probably damaging 1.000 0.124 phenotype 05/14/2014
48 191141 UTSW Lrp1 1.000 R1717 G1 168 Y 10 127556269 H2835R T C missense Het possibly damaging 0.590 0.086 phenotype 05/14/2014
49 191142 UTSW Lrp1 1.000 R1717 G1 225 Y 10 127563665 T2325A T C missense Het probably damaging 0.996 0.130 phenotype 05/14/2014
50 191102 UTSW Lrrd1 0.408 R1717 G1 225 Y 5 3850580 F295S T C missense Het probably damaging 0.991 0.098 05/14/2014
51 191144 UTSW Meis1 1.000 R1717 G1 225 Y 11 19010608 T A intron Het probably benign phenotype 05/14/2014
52 191107 UTSW Mkln1 0.326 R1717 G1 225 Y 6 31507644 I156K T A missense Het probably benign 0.000 0.122 phenotype 05/14/2014
53 191106 UTSW Mmd2 0.061 R1717 G1 225 Y 5 142575350 T C splice site Het probably benign 0.130 phenotype 05/14/2014
54 191165 UTSW Morc1 0.344 R1717 G1 225 Y 16 48452477 I156V A G missense Het probably benign 0.015 0.121 phenotype 05/14/2014
55 191164 UTSW Muc4 0.177 R1717 G1 225 N 16 32753405 T1094A A G missense Het possibly damaging 0.528 phenotype 05/14/2014
56 191088 UTSW Nckap1 1.000 R1717 G1 225 Y 2 80512670 A G splice site Het probably benign phenotype 05/14/2014
57 191086 UTSW Neb 0.581 R1717 G1 225 Y 2 52308747 I394T A G missense Het possibly damaging 0.545 0.070 phenotype 05/14/2014
58 191090 UTSW Olfr1111 0.283 R1717 G1 225 Y 2 87149806 L285* A T nonsense Het probably null 0.619 phenotype 05/14/2014
59 191091 UTSW Olfr1112 0.052 R1717 G1 225 Y 2 87191903 N72I A T missense Het probably benign 0.383 0.352 phenotype 05/14/2014
60 191158 UTSW Olfr1509 0.435 R1717 G1 225 Y 14 52450839 V142A T C missense Het probably benign 0.002 0.117 phenotype 05/14/2014
61 191146 UTSW Olfr331 0.064 R1717 G1 225 Y 11 58502059 M166L T A missense Het probably benign 0.092 0.236 phenotype 05/14/2014
62 191129 UTSW Olfr933 0.070 R1717 G1 225 Y 9 38976410 L245F C T missense Het probably damaging 0.997 0.054 phenotype 05/14/2014
63 314422 UTSW Pcdha1 0.000 R1717 G1 225 N 18 36932184 S634P T C missense Het probably benign 0.010 phenotype 05/04/2015
64 191172 UTSW Pcdhb12 0.056 R1717 G1 225 Y 18 37436788 V329E T A missense Het probably damaging 1.000 0.234 05/14/2014
65 191118 UTSW Pcf11 0.954 R1717 G1 225 Y 7 92663585 D193E A T missense Het probably benign 0.001 0.094 phenotype 05/14/2014
66 191154 UTSW Pcsk1 1.000 R1717 G1 225 Y 13 75110828 M240I G C missense Het probably damaging 0.988 0.108 phenotype 05/14/2014
67 191081 UTSW Pdc 0.081 R1717 G1 225 Y 1 150333141 I125N T A missense Het probably damaging 1.000 0.312 phenotype 05/14/2014
68 314418 UTSW Plch2 0.000 R1717 G1 141 N 4 154998272 G564S C T missense Het probably benign 0.000 phenotype 05/04/2015
69 191132 UTSW Rasgrf1 0.000 R1717 G1 225 Y 9 89953913 Q231H G T missense Het probably damaging 0.979 0.084 phenotype 05/14/2014
70 191153 UTSW Riok1 0.929 R1717 G1 225 Y 13 38052950 I389N T A missense Het probably damaging 1.000 0.302 phenotype 05/14/2014
71 191099 UTSW Ror1 1.000 R1717 G1 225 Y 4 100302938 S50R T A missense Het probably benign 0.000 0.072 phenotype 05/14/2014
72 191098 UTSW Samd13 0.160 R1717 G1 225 Y 3 146646315 T75A T C missense Het probably benign 0.312 0.154 05/14/2014
73 191092 UTSW Siglec1 0.070 R1717 G1 206 N 2 131073956 H1329Y G A missense Het possibly damaging 0.918 phenotype 05/14/2014
74 191093 UTSW Siglec1 0.070 R1717 G1 225 Y 2 131084012 N258S T C missense Het probably damaging 1.000 0.228 phenotype 05/14/2014
75 191103 UTSW Slbp 0.941 R1717 G1 225 Y 5 33645602 A126V G A missense Het probably benign 0.035 0.066 phenotype 05/14/2014
76 191128 UTSW Slc12a4 0.302 R1717 G1 225 Y 8 105947571 A T unclassified Het probably null 0.492 phenotype 05/14/2014
77 191147 UTSW Specc1 0.396 R1717 G1 225 Y 11 62128392 I686V A G missense Het possibly damaging 0.879 0.128 phenotype 05/14/2014
78 191097 UTSW Synpo2 0.148 R1717 G1 225 Y 3 123112554 V1038F C A missense Het probably damaging 0.999 0.086 05/14/2014
79 191140 UTSW Tbk1 1.000 R1717 G1 225 Y 10 121561645 T374I G A missense Het probably benign 0.098 0.222 phenotype 05/14/2014
80 191124 UTSW Tktl2 0.392 R1717 G1 225 Y 8 66512347 V186M G A missense Het probably damaging 0.978 0.206 05/14/2014
81 191112 UTSW Tmem190 0.000 R1717 G1 225 Y 7 4784133 L112P T C missense Het probably damaging 0.978 0.032 phenotype 05/14/2014
82 191169 UTSW Tsc2 1.000 R1717 G1 225 Y 17 24597068 R1715Q C T missense Het probably damaging 0.982 0.061 phenotype 05/14/2014
83 191108 UTSW Vmn1r46 0.026 R1717 G1 225 Y 6 89976829 L220P T C missense Het probably damaging 1.000 0.025 05/14/2014
84 191119 UTSW Vwa3a 0.164 R1717 G1 225 Y 7 120793386 Q816R A G missense Het probably benign 0.000 0.131 05/14/2014
85 191095 UTSW Zfhx4 0.568 R1717 G1 225 Y 3 5403104 I2799T T C missense Het probably benign 0.201 0.096 05/14/2014
86 191135 UTSW Zfp105 0.224 R1717 G1 225 Y 9 122930631 S456P T C missense Het probably damaging 1.000 0.338 phenotype 05/14/2014
[records 1 to 86 of 86]