Incidental Mutations

206 incidental mutations are currently displayed, and affect 136 genes.
29 are Possibly Damaging.
48 are Probably Damaging.
120 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 206] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 199224 UTSW 4930590J08Rik 0.061 R1730 G1 225 N 6 91919278 I369T T C missense Het possibly damaging 0.602 05/23/2014
2 199219 UTSW Aass 0.378 R1730 G1 225 N 6 23121019 D82G T C missense Het probably damaging 0.996 phenotype 05/23/2014
3 199269 UTSW Abi3bp 0.125 R1730 G1 225 N 16 56668279 V1258I G A missense Het possibly damaging 0.617 05/23/2014
4 199253 UTSW Acad11 0.251 R1730 G1 225 N 9 104063882 V41E T A missense Het probably benign 0.017 phenotype 05/23/2014
5 199217 UTSW Aff1 0.302 R1730 G1 225 N 5 103833512 L514V T G missense Het probably damaging 0.999 phenotype 05/23/2014
6 199263 UTSW Ankdd1b 0.073 R1730 G1 225 N 13 96460903 T7K G T missense Het probably damaging 0.992 05/23/2014
7 199187 UTSW Aspm 0.000 R1730 G1 225 N 1 139473574 I1111V A G missense Het probably benign 0.000 phenotype 05/23/2014
8 199236 UTSW Bag3 1.000 R1730 G1 117 N 7 128523859 M1L A T start codon destroyed Het possibly damaging 0.886 phenotype 05/23/2014
9 199020 UTSW C4bp 0.017 R1730 G1 225 N 1 130642988 V284L C G missense Het probably benign 0.040 05/23/2014
10 199151 UTSW Cacna1s 1.000 R1730 G1 225 N 1 136118716 F1761S T C missense Het probably benign 0.000 phenotype 05/23/2014
11 199159 UTSW Camsap2 0.564 R1730 G1 225 N 1 136281315 R802Q C T missense Het probably benign 0.001 05/23/2014
12 199261 UTSW Carmil1 0.204 R1730 G1 225 N 13 24041689 T635A T C missense Het probably damaging 0.995 phenotype 05/23/2014
13 199003 UTSW Ccdc93 0.188 R1730 G1 169 N 1 121456126 P192L C T missense Het probably benign 0.000 05/23/2014
14 199004 UTSW Ccdc93 0.188 R1730 G1 225 N 1 121461939 V237A T C missense Het probably benign 0.000 05/23/2014
15 199014 UTSW Cd55 0.000 R1730 G1 225 N 1 130449423 V333I C T missense Het probably benign 0.316 0.128 phenotype 05/23/2014
16 199016 UTSW Cd55 0.000 R1730 G1 225 N 1 130459633 A143S C A missense Het probably benign 0.000 phenotype 05/23/2014
17 198985 UTSW Cdh19 0.033 R1730 G1 225 N 1 110893384 E541D C A missense Het probably damaging 0.977 phenotype 05/23/2014
18 198984 UTSW Cdh7 0.118 R1730 G1 225 N 1 110065735 L307V C G missense Het possibly damaging 0.534 phenotype 05/23/2014
19 199252 UTSW Cep63 0.636 R1730 G1 225 N 9 102618867 I114F T A missense Het possibly damaging 0.930 phenotype 05/23/2014
20 199190 UTSW Cfh 0.105 R1730 G1 172 N 1 140147697 V268I C T missense Het possibly damaging 0.554 phenotype 05/23/2014
21 199188 UTSW Cfhr2 0.058 R1730 G1 225 N 1 139813442 M265T A G missense Het probably benign 0.001 05/23/2014
22 199189 UTSW Cfhr2 0.058 R1730 G1 225 N 1 139813459 N259K A C missense Het probably benign 0.017 05/23/2014
23 199079 UTSW Chil1 0.090 R1730 G1 216 N 1 134188529 A250V C T missense Het probably damaging 0.998 phenotype 05/23/2014
24 199213 UTSW Cnr1 0.186 R1730 G1 225 N 4 33943851 T80A A G missense Het possibly damaging 0.522 phenotype 05/23/2014
25 198988 UTSW Cntnap5a 0.157 R1730 G1 170 N 1 116455004 L1001I C A missense Het probably benign 0.001 phenotype 05/23/2014
26 198989 UTSW Cntnap5a 0.157 R1730 G1 225 N 1 116455101 L1033S T C missense Het probably benign 0.001 phenotype 05/23/2014
27 198990 UTSW Cntnap5a 0.157 R1730 G1 225 N 1 116455143 T1047I C T missense Het probably benign 0.015 phenotype 05/23/2014
28 199250 UTSW Col12a1 0.351 R1730 G1 225 N 9 79628378 V2612G A C missense Het possibly damaging 0.934 phenotype 05/23/2014
29 199182 UTSW Crb1 0.250 R1730 G1 225 N 1 139234779 M1214V T C missense Het probably benign 0.000 phenotype 05/23/2014
30 199183 UTSW Crb1 0.250 R1730 G1 225 N 1 139237622 H921Q A T missense Het probably benign 0.001 phenotype 05/23/2014
31 199184 UTSW Crb1 0.250 R1730 G1 225 N 1 139241138 P881S G A missense Het probably damaging 0.997 phenotype 05/23/2014
32 199185 UTSW Crb1 0.250 R1730 G1 225 N 1 139242995 G825R C T missense Het probably damaging 1.000 phenotype 05/23/2014
33 199186 UTSW Crb1 0.250 R1730 G1 225 N 1 139243417 R684H C T missense Het probably benign 0.005 phenotype 05/23/2014
34 199006 UTSW Cxcr4 0.747 R1730 G1 225 N 1 128589277 V216I C T missense Het probably benign 0.001 phenotype 05/23/2014
35 199084 UTSW Cyb5r1 0.174 R1730 G1 225 N 1 134407667 R147W C T missense Het probably damaging 1.000 05/23/2014
36 199277 UTSW Cyp2c29 0.089 R1730 G1 225 N 19 39324945 H295L A T missense Het possibly damaging 0.786 05/23/2014
37 199278 UTSW Cyp2c68 0.000 R1730 G1 225 N 19 39699275 M426K A T missense Het possibly damaging 0.872 05/23/2014
38 199161 UTSW Ddx59 0.953 R1730 G1 225 N 1 136417053 V154A T C missense Het probably benign 0.000 05/23/2014
39 198986 UTSW Dsel 0.211 R1730 G1 225 N 1 111859457 N1116S T C missense Het probably benign 0.000 0.136 phenotype 05/23/2014
40 198987 UTSW Dsel 0.211 R1730 G1 225 N 1 111859994 T937S G C missense Het probably benign 0.000 phenotype 05/23/2014
41 199274 UTSW Dsg2 0.168 R1730 G1 225 N 18 20591880 V448I G A missense Het probably benign 0.009 phenotype 05/23/2014
42 199046 UTSW Dstyk 0.235 R1730 G1 223 N 1 132456984 L739F C T missense Het probably damaging 1.000 phenotype 05/23/2014
43 199001 UTSW En1 1.000 R1730 G1 95 N 1 120603621 S197G A G missense Het unknown phenotype 05/23/2014
44 199225 UTSW Eogt 0.142 R1730 G1 225 N 6 97113864 D438G T C missense Het probably damaging 1.000 phenotype 05/23/2014
45 199060 UTSW Etnk2 0.260 R1730 G1 107 N 1 133363923 S54G A G missense Het probably benign 0.000 phenotype 05/23/2014
46 199061 UTSW Etnk2 0.260 R1730 G1 186 N 1 133365587 D89E C A missense Het probably benign 0.051 phenotype 05/23/2014
47 199062 UTSW Etnk2 0.260 R1730 G1 180 N 1 133365765 G149W G T missense Het probably damaging 1.000 phenotype 05/23/2014
48 199063 UTSW Etnk2 0.260 R1730 G1 119 N 1 133365816 R166* C T nonsense Het probably null phenotype 05/23/2014
49 199064 UTSW Etnk2 0.260 R1730 G1 225 N 1 133365817 R166Q G A missense Het probably benign 0.081 phenotype 05/23/2014
50 199067 UTSW Etnk2 0.260 R1730 G1 186 N 1 133376915 V292E T A missense Het probably benign 0.000 phenotype 05/23/2014
51 199212 UTSW Etnppl 0.118 R1730 G1 225 N 3 130620749 T98A A G missense Het probably damaging 0.996 05/23/2014
52 199209 UTSW Eya2 0.670 R1730 G1 225 N 2 165687663 G109W G T missense Het probably damaging 1.000 phenotype 05/23/2014
53 199222 UTSW Fam131b 0.180 R1730 G1 225 N 6 42318580 Q221P T G missense Het possibly damaging 0.749 05/23/2014
54 199034 UTSW Fam72a 0.205 R1730 G1 225 N 1 131530668 I56T T C missense Het probably benign 0.001 05/23/2014
55 199035 UTSW Fam72a 0.205 R1730 G1 225 N 1 131538895 T139M C T missense Het probably benign 0.001 05/23/2014
56 199021 UTSW Fcamr 0.067 R1730 G1 225 N 1 130811580 I206V A G missense Het probably benign 0.000 phenotype 05/23/2014
57 199022 UTSW Fcamr 0.067 R1730 G1 162 N 1 130812629 G262S G A missense Het probably benign 0.376 phenotype 05/23/2014
58 199023 UTSW Fcamr 0.067 R1730 G1 225 N 1 130812692 I283V A G missense Het probably benign 0.000 phenotype 05/23/2014
59 199024 UTSW Fcamr 0.067 R1730 G1 225 N 1 130812738 V298A T C missense Het probably benign 0.002 phenotype 05/23/2014
60 199025 UTSW Fcamr 0.067 R1730 G1 202 N 1 130812809 M322V A G missense Het probably benign 0.016 phenotype 05/23/2014
61 199026 UTSW Fcamr 0.067 R1730 G1 208 N 1 130812816 P324L C T missense Het probably benign 0.414 phenotype 05/23/2014
62 199027 UTSW Fcamr 0.067 R1730 G1 225 N 1 130814597 N574D A G missense Het probably benign 0.000 phenotype 05/23/2014
63 199029 UTSW Fcmr 0.000 R1730 G1 225 N 1 130875974 T172A A G missense Het probably benign 0.000 phenotype 05/23/2014
64 199030 UTSW Fcmr 0.000 R1730 G1 167 N 1 130878269 S321P T C missense Het probably benign 0.001 phenotype 05/23/2014
65 199256 UTSW Gabarap 0.000 R1730 G1 127 N 11 69991689 C T unclassified Het probably benign phenotype 05/23/2014
66 199238 UTSW Gatad2a R1730 G1 189 N 8 69909936 H600N G T missense Het probably damaging 1.000 phenotype 05/23/2014
67 199214 UTSW Gba2 0.491 R1730 G1 225 N 4 43578242 C36R A G missense Het probably benign 0.012 phenotype 05/23/2014
68 198992 UTSW Gli2 1.000 R1730 G1 225 N 1 118868087 A113T C T missense Het possibly damaging 0.679 phenotype 05/23/2014
69 198994 UTSW Gli2 1.000 R1730 G1 222 N 1 119002044 H44Q G T missense Het probably benign 0.001 phenotype 05/23/2014
70 199211 UTSW Gm10961 R1730 G1 225 N 3 107632994 T C unclassified Het probably benign 05/23/2014
71 199198 UTSW Gm4847 0.076 R1730 G1 225 N 1 166638339 D227G T C missense Het possibly damaging 0.800 05/23/2014
72 199105 UTSW Gpr37l1 0.080 R1730 G1 225 N 1 135161530 E266* C A nonsense Het probably null phenotype 05/23/2014
73 199241 UTSW Gucy1a2 0.223 R1730 G1 225 N 9 3634957 N334Y A T missense Het probably benign 0.360 phenotype 05/23/2014
74 199272 UTSW H2-D1 0.078 R1730 G1 204 N 17 35263405 T34A A G missense Het probably damaging 1.000 phenotype 05/23/2014
75 199139 UTSW Igfn1 0.195 R1730 G1 225 N 1 135959928 P2466L G A missense Het probably damaging 1.000 05/23/2014
76 199140 UTSW Igfn1 0.195 R1730 G1 225 N 1 135968199 A1543V G A missense Het probably benign 0.000 05/23/2014
77 199141 UTSW Igfn1 0.195 R1730 G1 217 N 1 135970411 S806G T C missense Het probably benign 0.000 05/23/2014
78 199142 UTSW Igfn1 0.195 R1730 G1 209 N 1 135972127 R482Q C T missense Het probably benign 0.000 05/23/2014
79 199144 UTSW Igfn1 0.195 R1730 G1 225 N 1 135979915 A231T C T missense Het probably benign 0.002 05/23/2014
80 199145 UTSW Igfn1 0.195 R1730 G1 225 N 1 135982475 R124W G A missense Het probably benign 0.000 05/23/2014
81 199146 UTSW Igfn1 0.195 R1730 G1 213 N 1 135998625 E29G T C missense Het probably benign 0.000 05/23/2014
82 199147 UTSW Igfn1 0.195 R1730 G1 225 N 1 135998683 I10V T C missense Het unknown 05/23/2014
83 199032 UTSW Ikbke 0.000 R1730 G1 225 N 1 131265937 A459S C A missense Het probably benign 0.012 phenotype 05/23/2014
84 199033 UTSW Ikbke 0.000 R1730 G1 203 N 1 131269823 S447G T C missense Het probably benign 0.003 phenotype 05/23/2014
85 199110 UTSW Ipo9 1.000 R1730 G1 217 N 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 05/23/2014
86 199114 UTSW Ipo9 1.000 R1730 G1 225 N 1 135402250 V484A A G missense Het probably benign 0.000 0.116 phenotype 05/23/2014
87 199262 UTSW Jarid2 1.000 R1730 G1 225 N 13 44906276 N661K T A missense Het probably damaging 0.999 0.112 phenotype 05/23/2014
88 199226 UTSW Kcna5 0.260 R1730 G1 225 N 6 126533860 I435N A T missense Het probably damaging 1.000 phenotype 05/23/2014
89 199243 UTSW Kcnj5 0.000 R1730 G1 225 N 9 32322192 I276V T C missense Het probably damaging 0.997 phenotype 05/23/2014
90 199191 UTSW Kcnt2 0.338 R1730 G1 217 N 1 140354547 S90N G A missense Het probably benign 0.000 phenotype 05/23/2014
91 199163 UTSW Kif14 0.769 R1730 G1 225 N 1 136468279 N108D A G missense Het probably benign 0.000 phenotype 05/23/2014
92 199164 UTSW Kif14 0.769 R1730 G1 225 N 1 136468975 K340E A G missense Het probably damaging 0.997 phenotype 05/23/2014
93 199165 UTSW Kif14 0.769 R1730 G1 225 N 1 136478365 A556T G A missense Het probably benign 0.003 phenotype 05/23/2014
94 199166 UTSW Kif14 0.769 R1730 G1 225 N 1 136490332 S868G A G missense Het probably benign 0.000 phenotype 05/23/2014
95 199169 UTSW Kif14 0.769 R1730 G1 225 N 1 136503431 L1189F C T missense Het probably benign 0.100 phenotype 05/23/2014
96 199170 UTSW Kif14 0.769 R1730 G1 225 N 1 136515961 F1291L T C missense Het probably benign 0.041 phenotype 05/23/2014
97 199171 UTSW Kif14 0.769 R1730 G1 225 N 1 136525783 V1433A T C missense Het probably benign 0.025 phenotype 05/23/2014
98 199196 UTSW Klhl20 0.163 R1730 G1 225 N 1 161102990 V314A A G missense Het possibly damaging 0.820 phenotype 05/23/2014
99 199129 UTSW Lad1 0.056 R1730 G1 225 N 1 135827381 P132S C T missense Het possibly damaging 0.899 phenotype 05/23/2014
100 199130 UTSW Lad1 0.056 R1730 G1 225 N 1 135828023 R346C C T missense Het probably damaging 0.998 phenotype 05/23/2014
[records 1 to 100 of 206] next >> last >|