Incidental Mutations

227 incidental mutations are currently displayed, and affect 153 genes.
27 are Possibly Damaging.
56 are Probably Damaging.
129 are Probably Benign.
13 are Probably Null.
5 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 227] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 195701 UTSW 4921539E11Rik 0.011 R1783 G1 225 N 4 103231089 T307S T A missense Het probably damaging 0.987 05/23/2014
2 195719 UTSW 4930590J08Rik 0.061 R1783 G1 225 N 6 91919278 I369T T C missense Het possibly damaging 0.602 05/23/2014
3 195754 UTSW Abhd17a 0.250 R1783 G1 225 N 10 80584026 I115F T A missense Het probably benign 0.016 05/23/2014
4 195712 UTSW Acacb 0.000 R1783 G1 139 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 05/23/2014
5 195702 UTSW Adgrb2 0.000 R1783 G1 225 N 4 130009305 T566I C T missense Het possibly damaging 0.613 phenotype 05/23/2014
6 195780 UTSW Adgrf4 0.000 R1783 G1 225 N 17 42666898 R518Q C T missense Het possibly damaging 0.928 0.194 phenotype 05/23/2014
7 195675 UTSW Aspm 0.000 R1783 G1 225 N 1 139473574 I1111V A G missense Het probably benign 0.000 phenotype 05/23/2014
8 195743 UTSW Bbs9 0.586 R1783 G1 225 N 9 22659119 V587A T C missense Het possibly damaging 0.849 phenotype 05/23/2014
9 195492 UTSW C4bp 0.017 R1783 G1 225 N 1 130642988 V284L C G missense Het probably benign 0.040 05/23/2014
10 195637 UTSW Cacna1s 1.000 R1783 G1 225 N 1 136118716 F1761S T C missense Het probably benign 0.000 phenotype 05/23/2014
11 195647 UTSW Camsap2 0.564 R1783 G1 225 N 1 136281315 R802Q C T missense Het probably benign 0.001 05/23/2014
12 195688 UTSW Capn8 0.000 R1783 G1 225 N 1 182598822 S241P T C missense Het probably damaging 1.000 phenotype 05/23/2014
13 195741 UTSW Capn9 0.181 R1783 G1 225 N 8 124605711 G430R G A missense Het possibly damaging 0.900 0.063 phenotype 05/23/2014
14 195735 UTSW Cars 1.000 R1783 G1 225 N 7 143592474 R71M C A missense Het probably damaging 0.998 0.306 phenotype 05/23/2014
15 195475 UTSW Ccdc93 0.188 R1783 G1 180 N 1 121456126 P192L C T missense Het probably benign 0.000 05/23/2014
16 195476 UTSW Ccdc93 0.188 R1783 G1 221 N 1 121461939 V237A T C missense Het probably benign 0.000 05/23/2014
17 195486 UTSW Cd55 0.000 R1783 G1 225 N 1 130449423 V333I C T missense Het probably benign 0.316 0.128 phenotype 05/23/2014
18 195488 UTSW Cd55 0.000 R1783 G1 225 N 1 130459633 A143S C A missense Het probably benign 0.000 phenotype 05/23/2014
19 195458 UTSW Cdh19 0.033 R1783 G1 225 N 1 110893384 E541D C A missense Het probably damaging 0.977 phenotype 05/23/2014
20 195457 UTSW Cdh7 0.118 R1783 G1 225 N 1 110065735 L307V C G missense Het possibly damaging 0.534 phenotype 05/23/2014
21 195685 UTSW Cep350 0.884 R1783 G1 225 N 1 155928865 L824R A C missense Het probably damaging 1.000 phenotype 05/23/2014
22 195678 UTSW Cfh 0.105 R1783 G1 225 N 1 140147697 V268I C T missense Het possibly damaging 0.554 phenotype 05/23/2014
23 195676 UTSW Cfhr2 0.058 R1783 G1 225 N 1 139813442 M265T A G missense Het probably benign 0.001 05/23/2014
24 195677 UTSW Cfhr2 0.058 R1783 G1 225 N 1 139813459 N259K A C missense Het probably benign 0.017 05/23/2014
25 195561 UTSW Chil1 0.090 R1783 G1 225 N 1 134188529 A250V C T missense Het probably damaging 0.998 phenotype 05/23/2014
26 195558 UTSW Chit1 0.145 R1783 G1 110 N 1 134149394 R312G A G missense Het possibly damaging 0.667 phenotype 05/23/2014
27 195559 UTSW Chit1 0.145 R1783 G1 98 N 1 134149395 R312I G T missense Het probably benign 0.026 phenotype 05/23/2014
28 195461 UTSW Cntnap5a 0.157 R1783 G1 225 N 1 116455004 L1001I C A missense Het probably benign 0.001 phenotype 05/23/2014
29 195462 UTSW Cntnap5a 0.157 R1783 G1 225 N 1 116455101 L1033S T C missense Het probably benign 0.001 phenotype 05/23/2014
30 195463 UTSW Cntnap5a 0.157 R1783 G1 225 N 1 116455143 T1047I C T missense Het probably benign 0.015 phenotype 05/23/2014
31 195670 UTSW Crb1 0.250 R1783 G1 225 N 1 139234779 M1214V T C missense Het probably benign 0.000 phenotype 05/23/2014
32 195671 UTSW Crb1 0.250 R1783 G1 225 N 1 139237622 H921Q A T missense Het probably benign 0.001 phenotype 05/23/2014
33 195672 UTSW Crb1 0.250 R1783 G1 225 N 1 139241138 P881S G A missense Het probably damaging 0.997 phenotype 05/23/2014
34 195673 UTSW Crb1 0.250 R1783 G1 225 N 1 139242995 G825R C T missense Het probably damaging 1.000 phenotype 05/23/2014
35 195674 UTSW Crb1 0.250 R1783 G1 225 N 1 139243417 R684H C T missense Het probably benign 0.005 phenotype 05/23/2014
36 195478 UTSW Cxcr4 0.747 R1783 G1 225 N 1 128589277 V216I C T missense Het probably benign 0.001 phenotype 05/23/2014
37 195567 UTSW Cyb5r1 0.174 R1783 G1 225 N 1 134407667 R147W C T missense Het probably damaging 1.000 05/23/2014
38 195649 UTSW Ddx59 0.953 R1783 G1 225 N 1 136417053 V154A T C missense Het probably benign 0.000 05/23/2014
39 195446 UTSW Dock10 0.374 R1783 G1 225 N 1 80574180 Y659S T G missense Het probably benign 0.173 phenotype 05/23/2014
40 195459 UTSW Dsel 0.211 R1783 G1 225 N 1 111859457 N1116S T C missense Het probably benign 0.000 0.136 phenotype 05/23/2014
41 195460 UTSW Dsel 0.211 R1783 G1 225 N 1 111859994 T937S G C missense Het probably benign 0.000 phenotype 05/23/2014
42 195781 UTSW Dsg2 0.168 R1783 G1 225 N 18 20591880 V448I G A missense Het probably benign 0.009 phenotype 05/23/2014
43 195523 UTSW Dstyk 0.235 R1783 G1 171 N 1 132456984 L739F C T missense Het probably damaging 1.000 phenotype 05/23/2014
44 195736 UTSW Efnb2 1.000 R1783 G1 198 N 8 8623237 T140K G T missense Het probably damaging 1.000 phenotype 05/23/2014
45 195473 UTSW En1 1.000 R1783 G1 119 N 1 120603621 S197G A G missense Het unknown phenotype 05/23/2014
46 195720 UTSW Eogt 0.142 R1783 G1 225 N 6 97113864 D438G T C missense Het probably damaging 1.000 phenotype 05/23/2014
47 195539 UTSW Etnk2 0.260 R1783 G1 94 N 1 133363923 S54G A G missense Het probably benign 0.000 phenotype 05/23/2014
48 195540 UTSW Etnk2 0.260 R1783 G1 220 N 1 133365587 D89E C A missense Het probably benign 0.051 phenotype 05/23/2014
49 195541 UTSW Etnk2 0.260 R1783 G1 174 N 1 133365765 G149W G T missense Het probably damaging 1.000 phenotype 05/23/2014
50 195542 UTSW Etnk2 0.260 R1783 G1 183 N 1 133365816 R166* C T nonsense Het probably null phenotype 05/23/2014
51 195543 UTSW Etnk2 0.260 R1783 G1 225 N 1 133365817 R166Q G A missense Het probably benign 0.081 phenotype 05/23/2014
52 195546 UTSW Etnk2 0.260 R1783 G1 200 N 1 133376915 V292E T A missense Het probably benign 0.000 phenotype 05/23/2014
53 195547 UTSW Etnk2 0.260 R1783 G1 82 N 1 133377046 A336S G T missense Het probably benign 0.382 phenotype 05/23/2014
54 195698 UTSW Etnppl 0.118 R1783 G1 225 N 3 130620749 T98A A G missense Het probably damaging 0.996 05/23/2014
55 195718 UTSW Fam131b 0.180 R1783 G1 225 N 6 42318580 Q221P T G missense Het possibly damaging 0.749 05/23/2014
56 195509 UTSW Fam72a 0.205 R1783 G1 225 N 1 131530668 I56T T C missense Het probably benign 0.001 05/23/2014
57 195510 UTSW Fam72a 0.205 R1783 G1 225 N 1 131538895 T139M C T missense Het probably benign 0.001 05/23/2014
58 195737 UTSW Fam90a1a 0.240 R1783 G1 225 N 8 21963463 N278S A G missense Het probably benign 0.000 05/23/2014
59 195774 UTSW Fbxo40 0.225 R1783 G1 225 N 16 36966222 M662L T A missense Het probably damaging 0.991 phenotype 05/23/2014
60 195494 UTSW Fcamr 0.067 R1783 G1 167 N 1 130804627 N117T A C missense Het probably benign 0.003 phenotype 05/23/2014
61 195496 UTSW Fcamr 0.067 R1783 G1 225 N 1 130811580 I206V A G missense Het probably benign 0.000 phenotype 05/23/2014
62 195497 UTSW Fcamr 0.067 R1783 G1 225 N 1 130812629 G262S G A missense Het probably benign 0.376 phenotype 05/23/2014
63 195498 UTSW Fcamr 0.067 R1783 G1 225 N 1 130812692 I283V A G missense Het probably benign 0.000 phenotype 05/23/2014
64 195499 UTSW Fcamr 0.067 R1783 G1 225 N 1 130812738 V298A T C missense Het probably benign 0.002 phenotype 05/23/2014
65 195500 UTSW Fcamr 0.067 R1783 G1 225 N 1 130812809 M322V A G missense Het probably benign 0.016 phenotype 05/23/2014
66 195501 UTSW Fcamr 0.067 R1783 G1 225 N 1 130812816 P324L C T missense Het probably benign 0.414 phenotype 05/23/2014
67 195502 UTSW Fcamr 0.067 R1783 G1 225 N 1 130814597 N574D A G missense Het probably benign 0.000 phenotype 05/23/2014
68 195504 UTSW Fcmr 0.000 R1783 G1 225 N 1 130875974 T172A A G missense Het probably benign 0.000 phenotype 05/23/2014
69 195505 UTSW Fcmr 0.000 R1783 G1 198 N 1 130878269 S321P T C missense Het probably benign 0.001 phenotype 05/23/2014
70 195687 UTSW Fmo9 0.067 R1783 G1 225 N 1 166673648 F192L A T missense Het probably benign 0.013 05/23/2014
71 195759 UTSW Gabarap 0.000 R1783 G1 131 N 11 69991689 C T unclassified Het probably benign phenotype 05/23/2014
72 195738 UTSW Gatad2a R1783 G1 225 N 8 69909936 H600N G T missense Het probably damaging 1.000 phenotype 05/23/2014
73 195760 UTSW Gemin4 0.972 R1783 G1 225 N 11 76211050 P962A G C missense Het probably damaging 1.000 0.208 phenotype 05/23/2014
74 195713 UTSW Git2 0.394 R1783 G1 225 N 5 114739124 E99G T C missense Het probably damaging 1.000 phenotype 05/23/2014
75 195465 UTSW Gli2 1.000 R1783 G1 225 N 1 118868087 A113T C T missense Het possibly damaging 0.679 phenotype 05/23/2014
76 195467 UTSW Gli2 1.000 R1783 G1 225 N 1 119002044 H44Q G T missense Het probably benign 0.001 phenotype 05/23/2014
77 195680 UTSW Glrx2 0.211 R1783 G1 132 N 1 143739740 A27V C T missense Het possibly damaging 0.904 phenotype 05/23/2014
78 195697 UTSW Gm10961 R1783 G1 225 N 3 107632994 T C unclassified Het probably benign 05/23/2014
79 195704 UTSW Gm13119 0.068 R1783 G1 100 N 4 144361725 E30D G T missense Het probably benign 0.011 05/23/2014
80 195646 UTSW Gpr25 0.309 R1783 G1 208 N 1 136260710 P55L G A missense Het probably benign 0.000 phenotype 05/23/2014
81 195779 UTSW Gpsm3 0.162 R1783 G1 225 N 17 34590754 R52H G A missense Het possibly damaging 0.942 phenotype 05/23/2014
82 195721 UTSW Grm7 0.000 R1783 G1 225 N 6 111358295 D556H G C missense Het probably damaging 0.998 phenotype 05/23/2014
83 195763 UTSW Hdac5 0.000 R1783 G1 225 N 11 102200516 F683L A G missense Het probably benign 0.000 phenotype 05/23/2014
84 195761 UTSW Ift20 1.000 R1783 G1 225 N 11 78540034 E68K G A missense Het probably damaging 0.995 0.188 phenotype 05/23/2014
85 195624 UTSW Igfn1 0.195 R1783 G1 225 N 1 135959928 P2466L G A missense Het probably damaging 1.000 05/23/2014
86 195625 UTSW Igfn1 0.195 R1783 G1 225 N 1 135968199 A1543V G A missense Het probably benign 0.000 05/23/2014
87 195626 UTSW Igfn1 0.195 R1783 G1 225 N 1 135970411 S806G T C missense Het probably benign 0.000 05/23/2014
88 195627 UTSW Igfn1 0.195 R1783 G1 225 N 1 135972127 R482Q C T missense Het probably benign 0.000 05/23/2014
89 195629 UTSW Igfn1 0.195 R1783 G1 225 N 1 135979915 A231T C T missense Het probably benign 0.002 05/23/2014
90 195630 UTSW Igfn1 0.195 R1783 G1 225 N 1 135982475 R124W G A missense Het probably benign 0.000 05/23/2014
91 195631 UTSW Igfn1 0.195 R1783 G1 225 N 1 135998625 E29G T C missense Het probably benign 0.000 05/23/2014
92 195632 UTSW Igfn1 0.195 R1783 G1 225 N 1 135998683 I10V T C missense Het unknown 05/23/2014
93 195507 UTSW Ikbke 0.000 R1783 G1 225 N 1 131265937 A459S C A missense Het probably benign 0.012 phenotype 05/23/2014
94 195508 UTSW Ikbke 0.000 R1783 G1 225 N 1 131269823 S447G T C missense Het probably benign 0.003 phenotype 05/23/2014
95 195593 UTSW Ipo9 1.000 R1783 G1 217 N 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 05/23/2014
96 195597 UTSW Ipo9 1.000 R1783 G1 225 N 1 135402250 V484A A G missense Het probably benign 0.000 0.116 phenotype 05/23/2014
97 195739 UTSW Irx5 0.000 R1783 G1 225 N 8 92359688 E133A A C missense Het probably damaging 1.000 phenotype 05/23/2014
98 195773 UTSW Itgb5 0.000 R1783 G1 225 N 16 33940562 T589I C T missense Het probably benign 0.128 phenotype 05/23/2014
99 195768 UTSW Jarid2 1.000 R1783 G1 225 N 13 44906276 N661K T A missense Het probably damaging 0.999 0.112 phenotype 05/23/2014
100 195722 UTSW Kcna5 0.260 R1783 G1 225 N 6 126533860 I435N A T missense Het probably damaging 1.000 phenotype 05/23/2014
[records 1 to 100 of 227] next >> last >|