Incidental Mutations

194 incidental mutations are currently displayed, and affect 134 genes.
23 are Possibly Damaging.
41 are Probably Damaging.
116 are Probably Benign.
13 are Probably Null.
6 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 194] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 196078 UTSW 4930453N24Rik 0.000 R1784 G1 225 N 16 64769022 I90V T C missense Het probably damaging 0.962 phenotype 05/23/2014
2 196019 UTSW Acacb 0.000 R1784 G1 165 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 05/23/2014
3 196029 UTSW Adamts17 0.151 R1784 G1 225 N 7 67149956 R1060* C T nonsense Het probably null phenotype 05/23/2014
4 196079 UTSW Adamts5 0.091 R1784 G1 225 N 16 85877915 K454* T A nonsense Het probably null phenotype 05/23/2014
5 196043 UTSW Adgrg6 1.000 R1784 G1 225 N 10 14439782 T593A T C missense Het probably damaging 1.000 phenotype 05/23/2014
6 196012 UTSW Aldh4a1 0.222 R1784 G1 225 N 4 139644161 Y462C A G missense Het probably damaging 0.999 phenotype 05/23/2014
7 196082 UTSW Ankrd12 0.250 R1784 G1 225 N 17 65984076 P1454Q G T missense Het probably benign 0.012 phenotype 05/23/2014
8 196034 UTSW Ap1m1 1.000 R1784 G1 225 N 8 72252849 S230T T A missense Het probably benign 0.006 phenotype 05/23/2014
9 195984 UTSW Aspm 0.000 R1784 G1 225 N 1 139473574 I1111V A G missense Het probably benign 0.000 phenotype 05/23/2014
10 196066 UTSW Atp6ap1l 0.054 R1784 G1 225 N 13 90905281 K4N T A missense Het probably damaging 0.959 05/23/2014
11 196077 UTSW Boc 0.000 R1784 G1 225 N 16 44496419 T454A T C missense Het probably benign 0.002 phenotype 05/23/2014
12 196004 UTSW Bola1 0.147 R1784 G1 192 N 3 96197110 G56D C T missense Het probably benign 0.000 05/23/2014
13 195800 UTSW C4bp 0.017 R1784 G1 225 N 1 130642988 V284L C G missense Het probably benign 0.040 05/23/2014
14 195945 UTSW Cacna1s 1.000 R1784 G1 225 N 1 136118716 F1761S T C missense Het probably benign 0.000 phenotype 05/23/2014
15 195956 UTSW Camsap2 0.564 R1784 G1 225 N 1 136281315 R802Q C T missense Het probably benign 0.001 05/23/2014
16 196036 UTSW Capn9 0.181 R1784 G1 225 N 8 124605711 G430R G A missense Het possibly damaging 0.900 0.063 phenotype 05/23/2014
17 196081 UTSW Cbs 0.585 R1784 G1 225 N 17 31620949 A337E G T missense Het probably benign 0.353 phenotype 05/23/2014
18 196025 UTSW Ccdc129 0.025 R1784 G1 225 N 6 55968541 F749S T C missense Het probably benign 0.006 05/23/2014
19 196086 UTSW Ccdc186 0.502 R1784 G1 225 N 19 56809220 H306Q A C missense Het probably benign 0.035 05/23/2014
20 196067 UTSW Cd180 0.000 R1784 G1 225 N 13 102705859 L471P T C missense Het probably damaging 1.000 phenotype 05/23/2014
21 195794 UTSW Cd55 0.000 R1784 G1 225 N 1 130449423 V333I C T missense Het probably benign 0.316 0.128 phenotype 05/23/2014
22 195796 UTSW Cd55 0.000 R1784 G1 225 N 1 130459633 A143S C A missense Het probably benign 0.000 phenotype 05/23/2014
23 196057 UTSW Cdk12 1.000 R1784 G1 225 N 11 98249970 T C unclassified Het probably benign phenotype 05/23/2014
24 195987 UTSW Cfh 0.105 R1784 G1 207 N 1 140147697 V268I C T missense Het possibly damaging 0.554 phenotype 05/23/2014
25 195985 UTSW Cfhr2 0.058 R1784 G1 225 N 1 139813442 M265T A G missense Het probably benign 0.001 05/23/2014
26 195986 UTSW Cfhr2 0.058 R1784 G1 225 N 1 139813459 N259K A C missense Het probably benign 0.017 05/23/2014
27 195870 UTSW Chil1 0.090 R1784 G1 225 N 1 134188529 A250V C T missense Het probably damaging 0.998 phenotype 05/23/2014
28 195868 UTSW Chit1 0.145 R1784 G1 81 N 1 134149394 R312G A G missense Het possibly damaging 0.667 phenotype 05/23/2014
29 196033 UTSW Chrna6 0.062 R1784 G1 225 N 8 27406784 M355K A T missense Het possibly damaging 0.596 phenotype 05/23/2014
30 196023 UTSW Clcn1 0.682 R1784 G1 225 N 6 42299514 F360Y T A missense Het possibly damaging 0.856 phenotype 05/23/2014
31 195995 UTSW Copa 0.981 R1784 G1 225 N 1 172111987 F597Y T A missense Het probably benign 0.000 phenotype 05/23/2014
32 195979 UTSW Crb1 0.250 R1784 G1 225 N 1 139234779 M1214V T C missense Het probably benign 0.000 phenotype 05/23/2014
33 195980 UTSW Crb1 0.250 R1784 G1 225 N 1 139237622 H921Q A T missense Het probably benign 0.001 phenotype 05/23/2014
34 195981 UTSW Crb1 0.250 R1784 G1 225 N 1 139241138 P881S G A missense Het probably damaging 0.997 phenotype 05/23/2014
35 195982 UTSW Crb1 0.250 R1784 G1 225 N 1 139242995 G825R C T missense Het probably damaging 1.000 phenotype 05/23/2014
36 195983 UTSW Crb1 0.250 R1784 G1 225 N 1 139243417 R684H C T missense Het probably benign 0.005 phenotype 05/23/2014
37 196044 UTSW Crybg1 0.194 R1784 G1 187 N 10 44004019 Q391L T A missense Het probably damaging 0.968 05/23/2014
38 196018 UTSW Cwh43 0.037 R1784 G1 225 N 5 73408218 L42P T C missense Het probably damaging 0.987 05/23/2014
39 195786 UTSW Cxcr4 0.747 R1784 G1 225 N 1 128589277 V216I C T missense Het probably benign 0.001 phenotype 05/23/2014
40 195877 UTSW Cyb5r1 0.174 R1784 G1 225 N 1 134407667 R147W C T missense Het probably damaging 1.000 05/23/2014
41 195958 UTSW Ddx59 0.953 R1784 G1 225 N 1 136417053 V154A T C missense Het probably benign 0.000 05/23/2014
42 196060 UTSW Dnah17 0.378 R1784 G1 221 N 11 118069519 C2572Y C T missense Het possibly damaging 0.759 phenotype 05/23/2014
43 196051 UTSW Dnah9 0.657 R1784 G1 225 N 11 66085020 T1401I G A missense Het possibly damaging 0.508 phenotype 05/23/2014
44 195830 UTSW Dstyk 0.235 R1784 G1 225 N 1 132456984 L739F C T missense Het probably damaging 1.000 phenotype 05/23/2014
45 196002 UTSW Elf2 0.300 R1784 G1 225 N 3 51257572 V277D A T missense Het probably damaging 0.969 05/23/2014
46 195848 UTSW Etnk2 0.260 R1784 G1 132 N 1 133363890 P43S C T missense Het probably benign 0.080 phenotype 05/23/2014
47 195849 UTSW Etnk2 0.260 R1784 G1 225 N 1 133365587 D89E C A missense Het probably benign 0.051 phenotype 05/23/2014
48 195850 UTSW Etnk2 0.260 R1784 G1 195 N 1 133365765 G149W G T missense Het probably damaging 1.000 phenotype 05/23/2014
49 195851 UTSW Etnk2 0.260 R1784 G1 225 N 1 133365816 R166* C T nonsense Het probably null phenotype 05/23/2014
50 195852 UTSW Etnk2 0.260 R1784 G1 225 N 1 133365817 R166Q G A missense Het probably benign 0.081 phenotype 05/23/2014
51 195855 UTSW Etnk2 0.260 R1784 G1 220 N 1 133376915 V292E T A missense Het probably benign 0.000 phenotype 05/23/2014
52 195856 UTSW Etnk2 0.260 R1784 G1 95 N 1 133377046 A336S G T missense Het probably benign 0.382 phenotype 05/23/2014
53 195816 UTSW Fam72a 0.205 R1784 G1 225 N 1 131530668 I56T T C missense Het probably benign 0.001 05/23/2014
54 195817 UTSW Fam72a 0.205 R1784 G1 225 N 1 131538895 T139M C T missense Het probably benign 0.001 05/23/2014
55 196037 UTSW Fat3 0.481 R1784 G1 225 N 9 15996315 V2797G A C missense Het possibly damaging 0.652 phenotype 05/23/2014
56 196074 UTSW Fbxl6 0.134 R1784 G1 225 N 15 76538058 R137H C T missense Het probably damaging 1.000 phenotype 05/23/2014
57 195801 UTSW Fcamr 0.067 R1784 G1 219 N 1 130804627 N117T A C missense Het probably benign 0.003 phenotype 05/23/2014
58 195803 UTSW Fcamr 0.067 R1784 G1 225 N 1 130811580 I206V A G missense Het probably benign 0.000 phenotype 05/23/2014
59 195804 UTSW Fcamr 0.067 R1784 G1 209 N 1 130812629 G262S G A missense Het probably benign 0.376 phenotype 05/23/2014
60 195805 UTSW Fcamr 0.067 R1784 G1 225 N 1 130812692 I283V A G missense Het probably benign 0.000 phenotype 05/23/2014
61 195806 UTSW Fcamr 0.067 R1784 G1 225 N 1 130812738 V298A T C missense Het probably benign 0.002 phenotype 05/23/2014
62 195807 UTSW Fcamr 0.067 R1784 G1 225 N 1 130812809 M322V A G missense Het probably benign 0.016 phenotype 05/23/2014
63 195808 UTSW Fcamr 0.067 R1784 G1 225 N 1 130812816 P324L C T missense Het probably benign 0.414 phenotype 05/23/2014
64 195809 UTSW Fcamr 0.067 R1784 G1 225 N 1 130814597 N574D A G missense Het probably benign 0.000 phenotype 05/23/2014
65 195811 UTSW Fcmr 0.000 R1784 G1 225 N 1 130875974 T172A A G missense Het probably benign 0.000 phenotype 05/23/2014
66 195812 UTSW Fcmr 0.000 R1784 G1 186 N 1 130878269 S321P T C missense Het probably benign 0.001 phenotype 05/23/2014
67 196053 UTSW Gabarap 0.000 R1784 G1 95 N 11 69991689 C T unclassified Het probably benign phenotype 05/23/2014
68 196021 UTSW Galnt17 0.262 R1784 G1 225 N 5 131150963 H115Q A T missense Het probably benign 0.355 phenotype 05/23/2014
69 196054 UTSW Gemin4 0.972 R1784 G1 225 N 11 76211050 P962A G C missense Het probably damaging 1.000 0.208 phenotype 05/23/2014
70 195989 UTSW Glrx2 0.211 R1784 G1 171 N 1 143739740 A27V C T missense Het possibly damaging 0.904 phenotype 05/23/2014
71 196014 UTSW Gm10563 0.047 R1784 G1 225 N 4 155635880 C T intron Het probably benign 05/23/2014
72 196011 UTSW Gm12887 0.078 R1784 G1 225 N 4 121616518 D45V T A missense Het probably benign 0.435 05/23/2014
73 196035 UTSW Gse1 0.239 R1784 G1 225 N 8 120568253 G A intron Het probably benign 05/23/2014
74 196050 UTSW Guk1 0.934 R1784 G1 225 N 11 59185312 V100E A T missense Het probably damaging 1.000 phenotype 05/23/2014
75 196062 UTSW Heatr4 0.083 R1784 G1 225 N 12 83967572 I630M T C missense Het probably benign 0.029 05/23/2014
76 196020 UTSW Hectd4 0.393 R1784 G1 225 N 5 121301839 Y1134F A T missense Het possibly damaging 0.514 05/23/2014
77 196055 UTSW Ift20 1.000 R1784 G1 225 N 11 78540034 E68K G A missense Het probably damaging 0.995 0.188 phenotype 05/23/2014
78 195933 UTSW Igfn1 0.195 R1784 G1 225 N 1 135959928 P2466L G A missense Het probably damaging 1.000 05/23/2014
79 195934 UTSW Igfn1 0.195 R1784 G1 225 N 1 135968199 A1543V G A missense Het probably benign 0.000 05/23/2014
80 195935 UTSW Igfn1 0.195 R1784 G1 225 N 1 135970411 S806G T C missense Het probably benign 0.000 05/23/2014
81 195936 UTSW Igfn1 0.195 R1784 G1 225 N 1 135972127 R482Q C T missense Het probably benign 0.000 05/23/2014
82 195938 UTSW Igfn1 0.195 R1784 G1 225 N 1 135979915 A231T C T missense Het probably benign 0.002 05/23/2014
83 195939 UTSW Igfn1 0.195 R1784 G1 225 N 1 135982475 R124W G A missense Het probably benign 0.000 05/23/2014
84 195940 UTSW Igfn1 0.195 R1784 G1 225 N 1 135998625 E29G T C missense Het probably benign 0.000 05/23/2014
85 195941 UTSW Igfn1 0.195 R1784 G1 225 N 1 135998683 I10V T C missense Het unknown 05/23/2014
86 195814 UTSW Ikbke 0.000 R1784 G1 225 N 1 131265937 A459S C A missense Het probably benign 0.012 phenotype 05/23/2014
87 195815 UTSW Ikbke 0.000 R1784 G1 225 N 1 131269823 S447G T C missense Het probably benign 0.003 phenotype 05/23/2014
88 195902 UTSW Ipo9 1.000 R1784 G1 217 N 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 05/23/2014
89 195906 UTSW Ipo9 1.000 R1784 G1 225 N 1 135402250 V484A A G missense Het probably benign 0.000 0.116 phenotype 05/23/2014
90 196061 UTSW Kcnh5 0.000 R1784 G1 225 N 12 75137691 D86G T C missense Het probably benign 0.177 phenotype 05/23/2014
91 195988 UTSW Kcnt2 0.338 R1784 G1 225 N 1 140354547 S90N G A missense Het probably benign 0.000 phenotype 05/23/2014
92 195959 UTSW Kif14 0.769 R1784 G1 225 N 1 136468279 N108D A G missense Het probably benign 0.000 phenotype 05/23/2014
93 195960 UTSW Kif14 0.769 R1784 G1 225 N 1 136468975 K340E A G missense Het probably damaging 0.997 phenotype 05/23/2014
94 195961 UTSW Kif14 0.769 R1784 G1 225 N 1 136478365 A556T G A missense Het probably benign 0.003 phenotype 05/23/2014
95 195962 UTSW Kif14 0.769 R1784 G1 204 N 1 136490332 S868G A G missense Het probably benign 0.000 phenotype 05/23/2014
96 195965 UTSW Kif14 0.769 R1784 G1 225 N 1 136503431 L1189F C T missense Het probably benign 0.100 phenotype 05/23/2014
97 195966 UTSW Kif14 0.769 R1784 G1 225 N 1 136515961 F1291L T C missense Het probably benign 0.041 phenotype 05/23/2014
98 195967 UTSW Kif14 0.769 R1784 G1 225 N 1 136525783 V1433A T C missense Het probably benign 0.025 phenotype 05/23/2014
99 196059 UTSW Kif18b 0.688 R1784 G1 225 N 11 102915541 A G critical splice donor site 2 bp Het probably null 05/23/2014
100 195950 UTSW Kif21b 0.193 R1784 G1 225 N 1 136160121 I983V A G missense Het possibly damaging 0.846 phenotype 05/23/2014
[records 1 to 100 of 194] next >> last >|