Incidental Mutations

83 incidental mutations are currently displayed, and affect 83 genes.
17 are Possibly Damaging.
25 are Probably Damaging.
29 are Probably Benign.
10 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 83 of 83] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 204251 UTSW 1700001K19Rik 0.056 R1859 G1 218 N 12 110670834 C T start gained Het probably benign 06/23/2014
2 204273 UTSW 9930021J03Rik 0.134 R1859 G1 225 N 19 29754923 C230G A C missense Het possibly damaging 0.533 06/23/2014
3 204183 UTSW Adcy10 0.171 R1859 G1 225 N 1 165521961 E467G A G missense Het probably damaging 1.000 phenotype 06/23/2014
4 204223 UTSW Alkbh8 0.000 R1859 G1 225 N 9 3385499 D597G A G missense Het probably benign 0.068 phenotype 06/23/2014
5 204195 UTSW Alpk1 0.000 R1859 G1 225 N 3 127681100 H418L T A missense Het possibly damaging 0.759 phenotype 06/23/2014
6 204211 UTSW Ano5 0.099 R1859 G1 225 N 7 51546833 V138L G T missense Het probably damaging 1.000 phenotype 06/23/2014
7 204252 UTSW Aspg 0.130 R1859 G1 225 N 12 112121172 I319K T A missense Het possibly damaging 0.856 06/23/2014
8 204268 UTSW Atp9b 0.166 R1859 G1 225 N 18 80749920 T970A T C missense Het possibly damaging 0.953 06/23/2014
9 204262 UTSW C4b 0.000 R1859 G1 225 N 17 34735553 M881L T A missense Het probably benign 0.000 phenotype 06/23/2014
10 204218 UTSW Cd209c 0.130 R1859 G1 225 N 8 3944953 N70K A T missense Het probably benign 0.000 06/23/2014
11 204269 UTSW Cdca5 1.000 R1859 G1 225 N 19 6090094 V95A T C missense Het possibly damaging 0.511 06/23/2014
12 204191 UTSW Cds2 1.000 R1859 G1 225 N 2 132302195 Y297C A G missense Het probably damaging 1.000 phenotype 06/23/2014
13 204194 UTSW Celsr2 0.000 R1859 G1 225 N 3 108396630 G2371S C T missense Het probably damaging 0.998 phenotype 06/23/2014
14 204201 UTSW Chd5 0.000 R1859 G1 225 N 4 152380523 I1557N T A missense Het probably benign 0.001 phenotype 06/23/2014
15 204224 UTSW Cntn5 0.000 R1859 G1 225 N 9 9972834 E266K C T missense Het probably damaging 0.995 phenotype 06/23/2014
16 204226 UTSW Crtam 0.059 R1859 G1 225 N 9 40973604 T363M G A missense Het possibly damaging 0.712 phenotype 06/23/2014
17 204243 UTSW Dnah2 0.000 R1859 G1 201 N 11 69437886 S3298P A G missense Het probably damaging 0.992 phenotype 06/23/2014
18 204207 UTSW Dok1 0.129 R1859 G1 225 N 6 83032245 Y209N A T missense Het probably damaging 1.000 phenotype 06/23/2014
19 204181 UTSW Dpp10 0.000 R1859 G1 225 N 1 123353604 D561G T C missense Het possibly damaging 0.474 phenotype 06/23/2014
20 204257 UTSW Drosha 0.960 R1859 G1 225 N 15 12878718 K710R A G missense Het probably benign 0.144 phenotype 06/23/2014
21 204232 UTSW Dse 0.236 R1859 G1 225 N 10 34153229 T622A T C missense Het probably benign 0.027 0.076 phenotype 06/23/2014
22 204254 UTSW Ercc6 0.452 R1859 G1 225 N 14 32526778 S429P T C missense Het probably damaging 0.999 phenotype 06/23/2014
23 204179 UTSW Fam135a 0.605 R1859 G1 225 N 1 24030225 V521E A T missense Het probably damaging 1.000 06/23/2014
24 204258 UTSW Fbxl7 0.000 R1859 G1 225 N 15 26543193 L456Q A T missense Het probably damaging 1.000 phenotype 06/23/2014
25 204267 UTSW Fbxo38 0.000 R1859 G1 225 N 18 62515418 I683T A G missense Het probably damaging 0.996 06/23/2014
26 204222 UTSW Foxc2 1.000 R1859 G1 151 N 8 121116625 R4L G T missense Het probably damaging 0.975 phenotype 06/23/2014
27 204228 UTSW Glyctk 0.000 R1859 G1 225 N 9 106157532 V112I C T missense Het probably benign 0.077 phenotype 06/23/2014
28 204233 UTSW Gm4981 0.075 R1859 G1 225 N 10 58235780 V204A A G missense Het probably benign 0.001 0.134 06/23/2014
29 204202 UTSW Guf1 0.700 R1859 G1 225 N 5 69568460 G481* G T nonsense Het probably null phenotype 06/23/2014
30 204253 UTSW Heatr1 0.968 R1859 G1 225 N 13 12403159 L324S T C missense Het probably damaging 1.000 06/23/2014
31 204249 UTSW Hectd1 1.000 R1859 G1 225 N 12 51806567 L57P A G missense Het probably damaging 0.996 phenotype 06/23/2014
32 204182 UTSW Hmcn1 0.000 R1859 G1 225 N 1 150657193 C3080S A T missense Het probably damaging 1.000 phenotype 06/23/2014
33 204220 UTSW Hsh2d 0.063 R1859 G1 225 N 8 72200460 D229N G A missense Het probably benign 0.006 0.148 phenotype 06/23/2014
34 204274 UTSW Ifit1 0.057 R1859 G1 225 N 19 34647544 F27I T A missense Het probably benign 0.001 phenotype 06/23/2014
35 204244 UTSW Ift20 1.000 R1859 G1 225 N 11 78540034 E68* G T nonsense Het probably null phenotype 06/23/2014
36 204261 UTSW Itsn1 0.000 R1859 G1 225 N 16 91889154 A G intron Het probably benign phenotype 06/23/2014
37 204203 UTSW Ksr2 0.118 R1859 G1 225 N 5 117414941 L38Q T A missense Het probably damaging 0.998 phenotype 06/23/2014
38 204231 UTSW Lama2 0.335 R1859 G1 225 N 10 27031082 M2361K A T missense Het possibly damaging 0.507 phenotype 06/23/2014
39 204217 UTSW Lrrc56 0.094 R1859 G1 225 N 7 141207508 M353V A G missense Het probably benign 0.000 06/23/2014
40 204248 UTSW Lsmem1 0.069 R1859 G1 108 N 12 40185261 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA frame shift Het probably null 06/23/2014
41 204250 UTSW Map3k9 0.000 R1859 G1 225 N 12 81724482 S800R A T missense Het possibly damaging 0.823 phenotype 06/23/2014
42 204212 UTSW Mef2a 1.000 R1859 G1 225 N 7 67266018 S179P A G missense Het probably damaging 0.972 phenotype 06/23/2014
43 204259 UTSW Micall1 0.092 R1859 G1 225 N 15 79122945 A G intron Het probably benign 06/23/2014
44 204239 UTSW Mpg 0.000 R1859 G1 225 N 11 32231957 A G unclassified 6 bp Het probably null 0.642 phenotype 06/23/2014
45 204264 UTSW Mpp7 0.129 R1859 G1 225 N 18 7350967 *577K A T makesense Het probably null phenotype 06/23/2014
46 204196 UTSW Msh4 0.498 R1859 G1 124 N 3 153905880 H35Q G T missense Het probably benign 0.000 phenotype 06/23/2014
47 204229 UTSW Mst1 0.000 R1859 G1 225 N 9 108084346 V601I G A missense Het probably benign 0.226 phenotype 06/23/2014
48 204242 UTSW Myh10 1.000 R1859 G1 225 N 11 68745413 N246K T A missense Het probably benign 0.025 phenotype 06/23/2014
49 204200 UTSW Myom3 0.130 R1859 G1 219 N 4 135779396 N493K C A missense Het probably benign 0.015 06/23/2014
50 204234 UTSW Mypn 0.249 R1859 G1 225 N 10 63146190 D537G T C missense Het probably benign 0.000 phenotype 06/23/2014
51 204219 UTSW Ncan 0.000 R1859 G1 225 N 8 70115348 M38K A T missense Het possibly damaging 0.943 phenotype 06/23/2014
52 204197 UTSW Ndufaf6 0.305 R1859 G1 225 N 4 11053474 H277Q G T missense Het probably benign 0.002 0.190 phenotype 06/23/2014
53 204204 UTSW Nos1 0.000 R1859 G1 225 N 5 117905462 N601Y A T missense Het possibly damaging 0.834 phenotype 06/23/2014
54 204270 UTSW Nrxn2 0.000 R1859 G1 225 N 19 6488795 V794I G A missense Het probably benign 0.012 0.154 phenotype 06/23/2014
55 204185 UTSW Olfr1099 0.068 R1859 G1 225 N 2 86959081 I126V T C missense Het probably damaging 0.991 phenotype 06/23/2014
56 204240 UTSW Olfr1390 0.091 R1859 G1 225 N 11 49341384 L284P T C missense Het probably damaging 1.000 phenotype 06/23/2014
57 204271 UTSW Olfr1495 0.094 R1859 G1 225 N 19 13768724 Y127* T A nonsense Het probably null phenotype 06/23/2014
58 204198 UTSW Olfr156 0.175 R1859 G1 225 N 4 43820779 I194N A T missense Het possibly damaging 0.906 phenotype 06/23/2014
59 204216 UTSW Olfr45 0.066 R1859 G1 225 N 7 140691658 V251E T A missense Het possibly damaging 0.796 phenotype 06/23/2014
60 204256 UTSW Parp4 0.137 R1859 G1 225 N 14 56648915 V1817A T C missense Het unknown phenotype 06/23/2014
61 204266 UTSW Pfdn1 0.923 R1859 G1 225 N 18 36451100 M60I C A missense Het probably benign 0.001 0.114 phenotype 06/23/2014
62 204275 UTSW Ppp1r3c 1.000 R1859 G1 225 N 19 36733611 N253S T C missense Het probably damaging 1.000 phenotype 06/23/2014
63 204206 UTSW Prdm5 0.000 R1859 G1 225 N 6 65831279 I42V A G missense Het probably benign 0.029 phenotype 06/23/2014
64 204187 UTSW Prom2 0.000 R1859 G1 161 N 2 127541097 Q75P T G missense Het probably damaging 0.974 phenotype 06/23/2014
65 204230 UTSW Ptpn23 1.000 R1859 G1 225 N 9 110388870 D669G T C missense Het possibly damaging 0.922 phenotype 06/23/2014
66 204186 UTSW Rag1 0.589 R1859 G1 225 N 2 101644062 D245G T C missense Het probably benign 0.025 phenotype 06/23/2014
67 204193 UTSW Rpl22l1 0.930 R1859 G1 225 N 3 28806598 T A splice site 6 bp Het probably null phenotype 06/23/2014
68 204210 UTSW Sars2 0.861 R1859 G1 184 N 7 28744312 V113A T C missense Het probably damaging 0.993 phenotype 06/23/2014
69 204236 UTSW Sbno2 0.316 R1859 G1 225 N 10 80058639 K1067* T A nonsense Het probably null phenotype 06/23/2014
70 204237 UTSW Sec61g 0.000 R1859 G1 225 N 11 16506371 A G critical splice donor site 2 bp Het probably null 0.592 06/23/2014
71 204190 UTSW Slc4a11 0.153 R1859 G1 225 N 2 130688012 M282K A T missense Het probably benign 0.003 phenotype 06/23/2014
72 204235 UTSW Slc5a4a 0.078 R1859 G1 225 N 10 76166735 S242P T C missense Het probably benign 0.273 0.072 06/23/2014
73 204241 UTSW Sparc 0.000 R1859 G1 225 N 11 55406508 A T critical splice donor site 2 bp Het probably null phenotype 06/23/2014
74 204245 UTSW Thra 0.889 R1859 G1 225 N 11 98756151 C33S T A missense Het probably damaging 0.979 phenotype 06/23/2014
75 204272 UTSW Tmem2 0.801 R1859 G1 225 N 19 21847977 V1213A T C missense Het possibly damaging 0.561 06/23/2014
76 204205 UTSW Trrap 1.000 R1859 G1 225 N 5 144830951 T2293S A T missense Het probably benign 0.035 phenotype 06/23/2014
77 204184 UTSW Ttn 1.000 R1859 G1 225 N 2 76894645 T A unclassified Het probably benign phenotype 06/23/2014
78 204221 UTSW Vat1l 0.088 R1859 G1 225 N 8 114271301 V195E T A missense Het probably damaging 1.000 06/23/2014
79 204208 UTSW Vmn1r60 0.072 R1859 G1 225 N 7 5544550 I184F T A missense Het possibly damaging 0.644 06/23/2014
80 204255 UTSW Wdfy4 0.000 R1859 G1 225 N 14 33103983 I1192T A G missense Het probably damaging 0.991 06/23/2014
81 204192 UTSW Zbtb10 0.337 R1859 G1 225 N 3 9280386 S737P T C missense Het possibly damaging 0.472 06/23/2014
82 204215 UTSW Zfp553 1.000 R1859 G1 225 N 7 127235345 E24G A G missense Het probably benign 0.039 phenotype 06/23/2014
83 204265 UTSW Zscan30 0.103 R1859 G1 212 N 18 23971467 A G exon Het noncoding transcript 0.102 06/23/2014
[records 1 to 83 of 83]