Incidental Mutations

113 incidental mutations are currently displayed, and affect 113 genes.
20 are Possibly Damaging.
44 are Probably Damaging.
40 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 113] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 208574 UTSW Adgrg2 0.000 R1864 G1 222 N X 160482351 M532I G A missense Het probably benign 0.010 0.138 phenotype 06/30/2014
2 208544 UTSW Agtpbp1 0.651 R1864 G1 225 N 13 59450202 Y1198H A G missense Het possibly damaging 0.923 phenotype 06/30/2014
3 208483 UTSW Ahcyl2 0.235 R1864 G1 225 N 6 29908355 V575M G A missense Het probably damaging 1.000 0.364 phenotype 06/30/2014
4 208469 UTSW AI314180 0.438 R1864 G1 225 N 4 58849942 H427L T A missense Het possibly damaging 0.617 06/30/2014
5 208442 UTSW Akp3 0.297 R1864 G1 102 N 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 06/30/2014
6 208463 UTSW Ankrd50 0.261 R1864 G1 225 N 3 38454461 N329K A T missense Het probably benign 0.023 06/30/2014
7 208525 UTSW Ano4 0.000 R1864 G1 225 N 10 88971391 G741V C A missense Het probably damaging 1.000 06/30/2014
8 208567 UTSW Anxa1 0.432 R1864 G1 225 N 19 20379689 D191G T C missense Het probably benign 0.001 phenotype 06/30/2014
9 208524 UTSW Apc2 0.447 R1864 G1 225 N 10 80313648 T1512I C T missense Het probably damaging 0.999 phenotype 06/30/2014
10 208517 UTSW Aph1b 0.000 R1864 G1 225 N 9 66794113 C81S A T missense Het probably benign 0.052 phenotype 06/30/2014
11 208445 UTSW Arhgap21 0.465 R1864 G1 225 N 2 20861204 E893G T C missense Het probably damaging 1.000 0.204 phenotype 06/30/2014
12 208547 UTSW Arhgef28 0.739 R1864 G1 225 N 13 97994132 H399Q A T missense Het probably benign 0.001 phenotype 06/30/2014
13 208464 UTSW Asic5 0.111 R1864 G1 225 N 3 82011987 E304G A G missense Het probably benign 0.003 phenotype 06/30/2014
14 208508 UTSW B4galnt4 0.492 R1864 G1 157 N 7 141070533 Y771C A G missense Het probably damaging 0.999 06/30/2014
15 208513 UTSW Birc2 0.638 R1864 G1 225 N 9 7819517 Q465K G T missense Het probably benign 0.058 phenotype 06/30/2014
16 208556 UTSW Btla 0.017 R1864 G1 225 N 16 45250374 T232I C T missense Het probably damaging 0.972 phenotype 06/30/2014
17 208516 UTSW Ccdc84 0.884 R1864 G1 225 N 9 44417721 C66R A G missense Het probably damaging 1.000 phenotype 06/30/2014
18 208534 UTSW Ccl7 0.023 R1864 G1 225 N 11 82046552 K37N G T missense Het probably benign 0.003 phenotype 06/30/2014
19 208526 UTSW Cdk17 0.573 R1864 G1 225 N 10 93226105 V233A T C missense Het probably damaging 0.996 phenotype 06/30/2014
20 208511 UTSW Cilp2 0.223 R1864 G1 148 N 8 69881323 Q1008H C A missense Het probably damaging 1.000 06/30/2014
21 208487 UTSW Clcn1 0.669 R1864 G1 225 N 6 42305541 D442E T A missense Het probably damaging 0.995 0.026 phenotype 06/30/2014
22 208474 UTSW Clcnka 0.000 R1864 G1 225 N 4 141392802 T269A T C missense Het probably damaging 0.986 phenotype 06/30/2014
23 208518 UTSW Col12a1 0.364 R1864 G1 225 N 9 79627103 A T splice site Het probably null phenotype 06/30/2014
24 208545 UTSW Cts6 0.044 R1864 G1 225 N 13 61201579 I105T A G missense Het probably benign 0.262 0.092 06/30/2014
25 208481 UTSW Cyp3a25 0.088 R1864 G1 225 N 5 145994929 D123G T C missense Het probably damaging 0.981 06/30/2014
26 208459 UTSW D630003M21Rik 0.118 R1864 G1 225 N 2 158203185 L808Q A T missense Het probably damaging 1.000 06/30/2014
27 208458 UTSW Ddrgk1 0.151 R1864 G1 225 N 2 130654295 I270N A T missense Het probably damaging 0.997 0.460 phenotype 06/30/2014
28 208479 UTSW Dhx15 0.914 R1864 G1 225 N 5 52184701 T92A T C missense Het possibly damaging 0.528 phenotype 06/30/2014
29 208506 UTSW Dhx32 0.196 R1864 G1 225 N 7 133737296 C197S A T missense Het probably benign 0.001 0.038 phenotype 06/30/2014
30 208572 UTSW Diaph2 R1864 G1 222 N X 129960127 R473Q G A missense Het probably damaging 0.999 phenotype 06/30/2014
31 208562 UTSW Dnd1 0.000 R1864 G1 225 N 18 36766004 C11R A G missense Het possibly damaging 0.928 phenotype 06/30/2014
32 208507 UTSW Dock1 1.000 R1864 G1 225 N 7 135146507 D1566A A C missense Het probably benign 0.070 phenotype 06/30/2014
33 208573 UTSW Drp2 0.081 R1864 G1 201 N X 134427115 I43V A G missense Het probably benign 0.029 phenotype 06/30/2014
34 208542 UTSW Ecm2 0.134 R1864 G1 225 N 13 49530145 V533A T C missense Het probably benign 0.284 0.090 phenotype 06/30/2014
35 208478 UTSW Emilin1 0.434 R1864 G1 225 N 5 30918590 E725G A G missense Het probably damaging 0.998 phenotype 06/30/2014
36 208493 UTSW Eml2 0.146 R1864 G1 189 N 7 19201878 Y487C A G missense Het probably damaging 1.000 06/30/2014
37 208566 UTSW Epg5 0.770 R1864 G1 225 N 18 77975031 L919H T A missense Het probably damaging 0.988 phenotype 06/30/2014
38 208536 UTSW Fam187a 0.197 R1864 G1 225 N 11 102886011 S214T T A missense Het probably damaging 0.998 06/30/2014
39 208570 UTSW Flna 0.439 R1864 G1 222 N X 74240263 T521A T C missense Het probably benign 0.001 phenotype 06/30/2014
40 208528 UTSW Foxi1 0.474 R1864 G1 225 N 11 34207531 I165F T A missense Het probably damaging 0.997 phenotype 06/30/2014
41 208530 UTSW Fxr2 0.412 R1864 G1 205 N 11 69652277 K633N A T missense Het probably benign 0.298 phenotype 06/30/2014
42 208501 UTSW Gdpd5 0.000 R1864 G1 225 N 7 99448999 I209T T C missense Het probably benign 0.038 phenotype 06/30/2014
43 208475 UTSW Gm13212 0.198 R1864 G1 181 N 4 145622428 Q145L A T missense Het possibly damaging 0.919 06/30/2014
44 208541 UTSW Gmpr 0.531 R1864 G1 225 N 13 45542625 V278F G T missense Het probably damaging 0.998 0.380 phenotype 06/30/2014
45 208489 UTSW Grm7 0.000 R1864 G1 225 N 6 111080423 D328V A T missense Het probably benign 0.029 phenotype 06/30/2014
46 208535 UTSW Heatr6 0.586 R1864 G1 225 N 11 83769230 S534P T C missense Het probably damaging 0.974 06/30/2014
47 208571 UTSW Heph 0.000 R1864 G1 222 N X 96529486 T792A A G missense Het probably damaging 1.000 phenotype 06/30/2014
48 208486 UTSW Hipk2 0.911 R1864 G1 225 N 6 38718935 T A critical splice acceptor site Het probably null phenotype 06/30/2014
49 208462 UTSW Hps3 0.195 R1864 G1 225 N 3 20019959 T A critical splice acceptor site Het probably null phenotype 06/30/2014
50 208447 UTSW Hspa5 1.000 R1864 G1 225 N 2 34774541 F336L T C missense Het probably damaging 0.992 0.258 phenotype 06/30/2014
51 208503 UTSW Insc 0.413 R1864 G1 225 N 7 114842178 I409T T C missense Het probably benign 0.060 phenotype 06/30/2014
52 208491 UTSW Kcnj8 1.000 R1864 G1 225 N 6 142570240 H47L T A missense Het probably damaging 0.999 0.258 phenotype 06/30/2014
53 208548 UTSW Kcnma1 0.827 R1864 G1 225 N 14 23803162 Q108L T A missense Het probably damaging 1.000 phenotype 06/30/2014
54 208494 UTSW Klc3 0.245 R1864 G1 210 N 7 19398041 V137A A G missense Het probably damaging 0.979 phenotype 06/30/2014
55 208446 UTSW Lcn2 0.000 R1864 G1 225 N 2 32385422 T194A T C missense Het possibly damaging 0.766 0.060 phenotype 06/30/2014
56 208452 UTSW Lgr4 1.000 R1864 G1 225 N 2 110011397 F576I T A missense Het possibly damaging 0.933 phenotype 06/30/2014
57 208448 UTSW Lypd6b 0.245 R1864 G1 225 N 2 49947447 I144V A G missense Het possibly damaging 0.952 06/30/2014
58 208546 UTSW Mctp1 0.170 R1864 G1 115 N 13 76385148 C205Y G A missense Het possibly damaging 0.629 0.244 06/30/2014
59 208488 UTSW Mitf 0.773 R1864 G1 225 N 6 98010422 N159I A T missense Het probably damaging 1.000 phenotype 06/30/2014
60 208557 UTSW Morc1 0.377 R1864 G1 225 N 16 48592530 I678T T C missense Het probably benign 0.008 phenotype 06/30/2014
61 208554 UTSW Muc4 0.167 R1864 G1 225 N 16 32756251 A G unclassified Het probably benign phenotype 06/30/2014
62 208500 UTSW Myo7a 0.000 R1864 G1 225 N 7 98052256 Y2115C T C missense Het probably damaging 1.000 phenotype 06/30/2014
63 208568 UTSW Myof 0.240 R1864 G1 225 N 19 37986705 I182V T C missense Het probably benign 0.000 phenotype 06/30/2014
64 208529 UTSW Ncor1 1.000 R1864 G1 225 N 11 62381419 V635A A G missense Het probably damaging 0.998 phenotype 06/30/2014
65 208449 UTSW Neb 0.554 R1864 G1 225 N 2 52212760 Y4257* G T nonsense Het probably null phenotype 06/30/2014
66 208468 UTSW Npr2 0.755 R1864 G1 225 N 4 43641258 V428E T A missense Het probably benign 0.298 phenotype 06/30/2014
67 208533 UTSW Nufip2 0.903 R1864 G1 225 N 11 77692298 D346G A G missense Het probably damaging 0.998 06/30/2014
68 208441 UTSW Obsl1 0.354 R1864 G1 225 N 1 75493109 S1088F G A missense Het probably benign 0.014 06/30/2014
69 208451 UTSW Olfr1262 0.054 R1864 G1 225 N 2 90002481 V25E T A missense Het probably benign 0.017 phenotype 06/30/2014
70 208453 UTSW Olfr1282 0.206 R1864 G1 225 N 2 111335707 V124M C T missense Het possibly damaging 0.949 phenotype 06/30/2014
71 208558 UTSW Olfr204 0.081 R1864 G1 225 N 16 59315015 Y131H A G missense Het probably damaging 1.000 phenotype 06/30/2014
72 208502 UTSW Olfr705 0.141 R1864 G1 225 N 7 106713823 N286S T C missense Het possibly damaging 0.865 phenotype 06/30/2014
73 208514 UTSW Olfr877 0.074 R1864 G1 225 N 9 37855264 Y149N T A missense Het probably damaging 0.999 phenotype 06/30/2014
74 208515 UTSW Olfr982 0.131 R1864 G1 225 N 9 40074785 I163M T G missense Het possibly damaging 0.878 phenotype 06/30/2014
75 208565 UTSW Pdgfrb 1.000 R1864 G1 225 N 18 61071717 V550I G A missense Het probably benign 0.002 phenotype 06/30/2014
76 208553 UTSW Pi4ka 1.000 R1864 G1 225 N 16 17367525 L237* A T nonsense Het probably null phenotype 06/30/2014
77 208450 UTSW Pla2r1 0.000 R1864 G1 225 N 2 60428711 T1111M G A missense Het probably benign 0.009 phenotype 06/30/2014
78 208490 UTSW Plxnd1 1.000 R1864 G1 212 N 6 115969441 A T unclassified Het probably null 0.624 phenotype 06/30/2014
79 208549 UTSW Pnp 0.134 R1864 G1 225 N 14 50947973 A67P G C missense Het probably benign 0.001 phenotype 06/30/2014
80 208482 UTSW Ppp1r3a 0.000 R1864 G1 225 N 6 14718405 S837T A T missense Het probably damaging 0.998 0.056 phenotype 06/30/2014
81 208538 UTSW Ppp2r5e 0.321 R1864 G1 225 N 12 75469567 A239P C G missense Het probably damaging 0.997 0.272 phenotype 06/30/2014
82 208457 UTSW Prom2 0.058 R1864 G1 225 N 2 127539787 D203G T C missense Het probably benign 0.005 phenotype 06/30/2014
83 208473 UTSW Pum1 0.000 R1864 G1 225 N 4 130751525 V486A T C missense Het possibly damaging 0.905 phenotype 06/30/2014
84 208465 UTSW Rnf115 0.429 R1864 G1 147 N 3 96727837 A G unclassified Het probably benign 06/30/2014
85 208499 UTSW Rsf1 0.597 R1864 G1 214 N 7 97579904 ATGGCG ATGGCGACGGTGGCG unclassified Het probably benign phenotype 06/30/2014
86 208467 UTSW Rusc2 0.369 R1864 G1 159 N 4 43421719 A713D C A missense Het possibly damaging 0.491 phenotype 06/30/2014
87 208454 UTSW Ryr3 0.378 R1864 G1 225 N 2 112730328 H3009Q A T missense Het possibly damaging 0.652 phenotype 06/30/2014
88 208539 UTSW Serpina1d 0.195 R1864 G1 225 N 12 103767997 C16F C A missense Het probably benign 0.213 06/30/2014
89 208532 UTSW Serpinf2 0.153 R1864 G1 225 N 11 75437483 R80S G T missense Het possibly damaging 0.737 phenotype 06/30/2014
90 208510 UTSW Sh2d4a 0.000 R1864 G1 225 N 8 68329315 Q192K C A missense Het probably benign 0.381 phenotype 06/30/2014
91 208472 UTSW Sh3d21 0.101 R1864 G1 225 N 4 126150936 T A critical splice acceptor site Het probably null 06/30/2014
92 208563 UTSW Sh3rf2 0.291 R1864 G1 225 N 18 42053981 L55Q T A missense Het probably damaging 0.990 06/30/2014
93 208456 UTSW Shc4 0.243 R1864 G1 225 N 2 125639367 D255G T C missense Het probably damaging 1.000 06/30/2014
94 208471 UTSW Skint2 0.069 R1864 G1 225 N 4 112625909 H170Q T A missense Het probably benign 0.096 06/30/2014
95 208480 UTSW Slc29a4 0.000 R1864 G1 225 N 5 142717754 Y261C A G missense Het probably damaging 0.999 phenotype 06/30/2014
96 208555 UTSW Slc35a5 0.137 R1864 G1 225 N 16 45143708 N102K A T missense Het possibly damaging 0.662 phenotype 06/30/2014
97 208520 UTSW Slc38a3 0.569 R1864 G1 225 N 9 107655953 I307K A T missense Het probably damaging 1.000 phenotype 06/30/2014
98 208498 UTSW Sv2b 0.000 R1864 G1 225 N 7 75124080 S548T A T missense Het probably benign 0.168 phenotype 06/30/2014
99 208543 UTSW Tgfbi 0.183 R1864 G1 225 N 13 56632881 S524P T C missense Het probably benign 0.156 phenotype 06/30/2014
100 208455 UTSW Tgm5 0.517 R1864 G1 187 N 2 121075218 D152G T C missense Het probably damaging 0.999 phenotype 06/30/2014
[records 1 to 100 of 113] next >> last >|