Incidental Mutations

87 incidental mutations are currently displayed, and affect 87 genes.
16 are Possibly Damaging.
33 are Probably Damaging.
23 are Probably Benign.
14 are Probably Null.
5 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 87 of 87] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 209837 UTSW 4930579C12Rik 0.160 R1889 G1 225 Y 9 89152762 A G splice site Het noncoding transcript 06/30/2014
2 209866 UTSW 9130008F23Rik 0.026 R1889 G1 225 Y 17 40880302 R79G T C missense Het probably damaging 1.000 0.400 06/30/2014
3 209805 UTSW Aco1 0.512 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null 0.500 phenotype 06/30/2014
4 209803 UTSW Acp6 0.197 R1889 G1 225 Y 3 97165885 R81W C T missense Het probably damaging 0.981 0.030 phenotype 06/30/2014
5 209824 UTSW Agbl1 0.111 R1889 G1 225 Y 7 76589381 Y543S A C missense Het probably damaging 0.995 0.168 phenotype 06/30/2014
6 209813 UTSW Anapc7 0.924 R1889 G1 225 Y 5 122433476 W205R T C missense Het probably damaging 1.000 0.512 phenotype 06/30/2014
7 209851 UTSW Ap1g2 0.251 R1889 G1 165 Y 14 55101429 M532L T A missense Het probably damaging 0.997 0.086 phenotype 06/30/2014
8 209850 UTSW Appl1 0.204 R1889 G1 225 Y 14 26925513 A G splice site Het probably benign phenotype 06/30/2014
9 209806 UTSW Arhgef19 0.284 R1889 G1 201 Y 4 141249313 F462S T C missense Het probably damaging 1.000 0.250 phenotype 06/30/2014
10 265989 UTSW Astn1 0.200 R1889 G1 225 N 1 158505316 A G intron Het probably null phenotype 02/05/2015
11 209873 UTSW AU015836 0.439 R1889 G1 222 Y X 93969379 T C utr 5 prime Het probably benign 0.062 06/30/2014
12 209820 UTSW Cacna1c 0.727 R1889 G1 225 Y 6 118612625 R1446H C T missense Het probably damaging 1.000 0.036 phenotype 06/30/2014
13 209862 UTSW Cadm2 0.352 R1889 G1 225 Y 16 66882795 D50G T C missense Het probably damaging 1.000 0.200 phenotype 06/30/2014
14 209826 UTSW Ccdc81 0.172 R1889 G1 225 Y 7 89882294 Q324* G A nonsense Het probably null 0.617 06/30/2014
15 209845 UTSW Cd300lf 0.095 R1889 G1 225 Y 11 115120380 V178A A G missense Het probably benign 0.006 0.098 phenotype 06/30/2014
16 209833 UTSW Cdt1 0.971 R1889 G1 110 Y 8 122572052 V476A T C missense Het possibly damaging 0.845 0.128 phenotype 06/30/2014
17 209852 UTSW Cenpj 1.000 R1889 G1 225 Y 14 56558725 V225A A G missense Het probably benign 0.433 0.110 phenotype 06/30/2014
18 209834 UTSW Cep295 0.929 R1889 G1 225 Y 9 15332103 T1686A T C missense Het possibly damaging 0.944 0.018 06/30/2014
19 209840 UTSW Cfap54 0.173 R1889 G1 225 Y 10 93034710 S684P A G missense Het possibly damaging 0.939 0.036 phenotype 06/30/2014
20 209814 UTSW Clip1 0.000 R1889 G1 225 Y 5 123653496 V204F C A missense Het probably damaging 0.994 0.034 phenotype 06/30/2014
21 209815 UTSW Cnpy4 0.145 R1889 G1 225 Y 5 138192840 E226G A G missense Het probably benign 0.064 0.252 phenotype 06/30/2014
22 209786 UTSW Col6a3 0.000 R1889 G1 225 Y 1 90803711 M1000L T A missense Het probably benign 0.005 0.078 phenotype 06/30/2014
23 209857 UTSW Cpsf1 0.983 R1889 G1 225 Y 15 76602156 M335V T C missense Het probably benign 0.065 0.042 phenotype 06/30/2014
24 209798 UTSW Dnmt3b 1.000 R1889 G1 225 Y 2 153676759 A614E C A missense Het probably benign 0.000 0.125 phenotype 06/30/2014
25 209800 UTSW Dpm1 0.385 R1889 G1 225 Y 2 168217735 R147Q C T missense Het possibly damaging 0.669 0.043 phenotype 06/30/2014
26 265990 UTSW Dpp7 0.161 R1889 G1 225 N 2 25353679 G T synonymous Het probably null phenotype 02/05/2015
27 209846 UTSW Engase 0.137 R1889 G1 225 Y 11 118478933 F57S T C missense Het probably damaging 0.998 0.176 phenotype 06/30/2014
28 209789 UTSW Epb41l5 1.000 R1889 G1 225 Y 1 119549172 D718G T C missense Het possibly damaging 0.816 0.068 phenotype 06/30/2014
29 209844 UTSW Fam20a 0.000 R1889 G1 225 Y 11 109673554 K458E T C missense Het probably benign 0.296 0.052 phenotype 06/30/2014
30 209807 UTSW Fbxo44 0.107 R1889 G1 225 Y 4 148156269 R220S C G missense Het probably damaging 1.000 0.272 phenotype 06/30/2014
31 209818 UTSW Gkn2 0.010 R1889 G1 225 Y 6 87378155 Y115* T A nonsense Het probably null 0.655 phenotype 06/30/2014
32 209793 UTSW Gtdc1 0.110 R1889 G1 225 Y 2 44591914 S246P A G missense Het probably damaging 1.000 0.234 06/30/2014
33 209865 UTSW H2-Q2 0.056 R1889 G1 225 Y 17 35345176 D302G A G missense Het probably benign 0.237 0.062 06/30/2014
34 209823 UTSW Herc2 0.860 R1889 G1 225 Y 7 56189813 S3357L C T missense Het possibly damaging 0.603 0.310 phenotype 06/30/2014
35 209817 UTSW Herc6 0.101 R1889 G1 225 Y 6 57662075 Y840* T A nonsense Het probably null 0.576 phenotype 06/30/2014
36 209816 UTSW Hoxa10 0.000 R1889 G1 105 Y 6 52234492 GGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 06/30/2014
37 209819 UTSW Ift122 1.000 R1889 G1 119 Y 6 115894421 T C critical splice donor site 2 bp Het probably null 0.450 phenotype 06/30/2014
38 209835 UTSW Ilf3 1.000 R1889 G1 174 Y 9 21404767 T A unclassified Het probably benign 0.106 phenotype 06/30/2014
39 209839 UTSW Itgb2 0.420 R1889 G1 225 Y 10 77548623 N193Y A T missense Het possibly damaging 0.744 0.184 phenotype 06/30/2014
40 209859 UTSW Itgb5 0.000 R1889 G1 225 Y 16 33910469 I65S T G missense Het probably damaging 1.000 0.202 phenotype 06/30/2014
41 209863 UTSW Jpt2 0.093 R1889 G1 91 Y 17 24960611 M1V T C start codon destroyed Het probably null 0.706 0.352 06/30/2014
42 209790 UTSW Kcnt2 0.338 R1889 G1 225 Y 1 140584293 H995L A T missense Het probably damaging 0.999 0.218 phenotype 06/30/2014
43 209871 UTSW Kif20b 0.644 R1889 G1 225 Y 19 34941208 T C unclassified Het probably benign 0.115 phenotype 06/30/2014
44 209825 UTSW Kif7 1.000 R1889 G1 225 Y 7 79710463 Y342C T C missense Het probably damaging 1.000 0.574 phenotype 06/30/2014
45 209808 UTSW Klhl21 0.294 R1889 G1 87 Y 4 152015420 V529A T C missense Het possibly damaging 0.908 0.262 06/30/2014
46 258026 UTSW Klhl26 0.114 R1889 G1 72 Y 8 70451733 D475G T C missense Het probably damaging 0.989 0.094 01/14/2015
47 209872 UTSW Lcor 0.312 R1889 G1 225 Y 19 41559128 Y384H T C missense Het probably damaging 0.994 0.224 phenotype 06/30/2014
48 209792 UTSW Lrp1b 0.000 R1889 G1 225 Y 2 40919167 C2463* A T nonsense Het probably null 0.659 phenotype 06/30/2014
49 209854 UTSW March6 0.625 R1889 G1 225 Y 15 31459193 E909G T C missense Het possibly damaging 0.855 0.338 phenotype 06/30/2014
50 209791 UTSW Mrc1 0.051 R1889 G1 225 Y 2 14308677 A T critical splice acceptor site Het probably null 0.590 phenotype 06/30/2014
51 209842 UTSW Nipal4 0.200 R1889 G1 225 Y 11 46150733 I212F T A missense Het probably damaging 0.994 0.106 phenotype 06/30/2014
52 209827 UTSW Nup98 1.000 R1889 G1 225 Y 7 102160716 T536S T A missense Het probably damaging 0.999 0.278 phenotype 06/30/2014
53 209811 UTSW Nwd2 0.266 R1889 G1 225 Y 5 63807666 E1531G A G missense Het possibly damaging 0.491 0.044 06/30/2014
54 209836 UTSW Nxpe2 0.043 R1889 G1 225 Y 9 48326614 T114A T C missense Het probably damaging 0.994 0.046 06/30/2014
55 209861 UTSW Olfr204 0.070 R1889 G1 225 Y 16 59314963 Y148S T G missense Het probably damaging 0.983 0.252 phenotype 06/30/2014
56 209870 UTSW Oosp1 0.228 R1889 G1 225 Y 19 11667794 V169I C T missense Het possibly damaging 0.455 0.066 06/30/2014
57 209858 UTSW Opa1 1.000 R1889 G1 225 Y 16 29625585 V863A T C missense Het possibly damaging 0.674 0.202 phenotype 06/30/2014
58 209802 UTSW Pabpc4l 0.117 R1889 G1 225 Y 3 46446363 M282K A T missense Het probably benign 0.001 0.134 06/30/2014
59 209860 UTSW Parp14 0.392 R1889 G1 225 Y 16 35856760 A946V G A missense Het probably benign 0.089 0.072 phenotype 06/30/2014
60 209869 UTSW Pcnx3 0.191 R1889 G1 225 Y 19 5672656 D1336G T C missense Het probably damaging 1.000 0.422 06/30/2014
61 209787 UTSW Phlpp1 0.287 R1889 G1 225 Y 1 106318850 V590A T C missense Het possibly damaging 0.948 0.144 phenotype 06/30/2014
62 209797 UTSW Rbck1 0.000 R1889 G1 163 Y 2 152318356 T468S T A missense Het probably damaging 0.989 0.276 phenotype 06/30/2014
63 209848 UTSW Ripor2 0.223 R1889 G1 225 Y 13 24693887 I290N T A missense Het probably damaging 1.000 0.326 phenotype 06/30/2014
64 209855 UTSW Rnf139 0.224 R1889 G1 225 Y 15 58899497 L457P T C missense Het probably damaging 1.000 0.280 phenotype 06/30/2014
65 209847 UTSW Rtn1 0.314 R1889 G1 225 Y 12 72304410 A342S C A missense Het possibly damaging 0.873 0.050 phenotype 06/30/2014
66 209810 UTSW Sema3d 0.000 R1889 G1 225 Y 5 12485021 A G splice site 4 bp Het probably null 0.633 phenotype 06/30/2014
67 209788 UTSW Serpinb2 0.045 R1889 G1 225 Y 1 107524607 V305D T A missense Het probably damaging 1.000 0.388 phenotype 06/30/2014
68 209828 UTSW Sez6l2 0.000 R1889 G1 225 Y 7 126953496 V148A T C missense Het probably damaging 0.999 0.134 phenotype 06/30/2014
69 209831 UTSW Shank2 0.000 R1889 G1 225 Y 7 144186858 S568* C A nonsense Het probably null 0.684 phenotype 06/30/2014
70 209849 UTSW Skiv2l2 0.980 R1889 G1 191 Y 13 112887490 N707S T C missense Het probably benign 0.001 0.094 06/30/2014
71 209812 UTSW Slc10a4 0.236 R1889 G1 225 Y 5 73012147 S372P T C missense Het possibly damaging 0.909 0.060 phenotype 06/30/2014
72 209801 UTSW Slc10a5 0.060 R1889 G1 225 Y 3 10335490 T37A T C missense Het probably benign 0.329 0.140 06/30/2014
73 209868 UTSW Slc14a1 0.000 R1889 G1 225 Y 18 78109697 I276V T C missense Het possibly damaging 0.950 0.178 phenotype 06/30/2014
74 209838 UTSW Slc6a20b 0.166 R1889 G1 199 Y 9 123632204 D52E G T missense Het probably benign 0.021 0.127 06/30/2014
75 209822 UTSW Slc6a5 1.000 R1889 G1 225 Y 7 49951434 M661T T C missense Het probably benign 0.027 0.040 phenotype 06/30/2014
76 209843 UTSW Ssh2 0.202 R1889 G1 225 Y 11 77449745 D574E C G missense Het probably damaging 0.999 0.218 phenotype 06/30/2014
77 209809 UTSW Steap4 0.237 R1889 G1 225 Y 5 7975892 R151L G T missense Het probably damaging 0.999 0.272 phenotype 06/30/2014
78 209799 UTSW Sun5 0.089 R1889 G1 225 Y 2 153865995 I107L T A missense Het probably benign 0.112 0.044 06/30/2014
79 209832 UTSW Tacc1 0.382 R1889 G1 225 Y 8 25175253 V488M C T missense Het probably damaging 0.988 0.468 phenotype 06/30/2014
80 209804 UTSW Tgs1 1.000 R1889 G1 225 Y 4 3614928 T829A A G missense Het probably benign 0.306 0.282 phenotype 06/30/2014
81 209864 UTSW Tnxb 0.000 R1889 G1 225 Y 17 34695825 E1929G A G missense Het probably damaging 0.971 0.028 phenotype 06/30/2014
82 209829 UTSW Tssc4 0.073 R1889 G1 225 Y 7 143070555 Q200P A C missense Het probably damaging 0.999 0.246 phenotype 06/30/2014
83 209794 UTSW Ttn 1.000 R1889 G1 225 Y 2 76758532 W21398R A G missense Het probably damaging 1.000 0.366 phenotype 06/30/2014
84 209796 UTSW Usp50 0.100 R1889 G1 225 Y 2 126777898 C T critical splice donor site 1 bp Het probably null 0.448 06/30/2014
85 265991 UTSW Usp9y 0.066 R1889 G1 222 N Y 1448829 A T intron 22 bp Het probably null phenotype 02/05/2015
86 209821 UTSW V1rd19 0.045 R1889 G1 225 Y 7 24003207 F33I T A missense Het probably benign 0.062 0.145 06/30/2014
87 209856 UTSW Zfat 1.000 R1889 G1 225 Y 15 68101539 T1118A T C missense Het probably benign 0.003 0.090 phenotype 06/30/2014
[records 1 to 87 of 87]