• Beutler Lab
  APN
• Strains @ MMRRC
• Display Strains By
  • Institution
  • Phenotype
  • Author
  • Chromosome
  • Inheritance
  • Multifield Search
• Search Mutagenetix
  
  
• Staff Login
• Download

Incidental Mutations

87 incidental mutations are currently displayed, and affect 87 genes.

16 are Possibly Damaging.

33 are Probably Damaging.

23 are Probably Benign.

14 are Probably Null.

5 create premature stop codons.

4 are critical splice junction mutations.

---

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing

[records 1 to 87 of 87] 10 25 50 100 500 1000 per page Full List
	ID	Source UTSW APN	Gene	E-score	Stock #	Gen G0 G0' G1 G2 G3 G3R F1 F2 F3 C0 C1 C2 C3 D1 HES IPS A3	Quality -	Vld Y N ?	Strain	Chr 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 X Y	Position	Mutation A R N D C E Q G H I L K M F P S T W Y V * A R N D C E Q G H I L K M F P S T W Y V *	Ref A C G T -	Var A C G T -	Type makesense missense nonsense start codon destroyed start gained synonymous splice acceptor site splice donor site critical splice acceptor site critical splice donor site splice site large deletion large insertion rearrangement small deletion small insertion exon frame shift intragenic intron utr 3 prime utr 5 prime unclassified	Exon Dist	Zygosity Homo Het Hemi Null	Predicted Effect unknown probably benign probably null possibly damaging probably damaging noncoding transcript silent not run no transcript	PPH Score -	Meta Score	MGI Phenotype available none listed	Posted
1	209837		4930579C12Rik	0.160	R1889	G1	225	Y		9	89152762		A	G	splice site		Het	noncoding transcript				06/30/2014
2	209866		9130008F23Rik	0.026	R1889	G1	225	Y		17	40880302	R79G	T	C	missense		Het	probably damaging	1.000	0.400		06/30/2014
3	209805		Aco1	0.512	R1889	G1	225	Y		4	40164607		A	T	critical splice acceptor site		Het	probably null		0.500	phenotype	06/30/2014
4	209803		Acp6	0.197	R1889	G1	225	Y		3	97165885	R81W	C	T	missense		Het	probably damaging	0.981	0.030	phenotype	06/30/2014
5	209824		Agbl1	0.111	R1889	G1	225	Y		7	76589381	Y543S	A	C	missense		Het	probably damaging	0.995	0.168	phenotype	06/30/2014
6	209813		Anapc7	0.924	R1889	G1	225	Y		5	122433476	W205R	T	C	missense		Het	probably damaging	1.000	0.512	phenotype	06/30/2014
7	209851		Ap1g2	0.251	R1889	G1	165	Y		14	55101429	M532L	T	A	missense		Het	probably damaging	0.997	0.086	phenotype	06/30/2014
8	209850		Appl1	0.204	R1889	G1	225	Y		14	26925513		A	G	splice site		Het	probably benign			phenotype	06/30/2014
9	209806		Arhgef19	0.284	R1889	G1	201	Y		4	141249313	F462S	T	C	missense		Het	probably damaging	1.000	0.250	phenotype	06/30/2014
10	265989		Astn1	0.200	R1889	G1	225	N		1	158505316		A	G	intron		Het	probably null			phenotype	02/05/2015
11	209873		AU015836	0.439	R1889	G1	222	Y		X	93969379		T	C	utr 5 prime		Het	probably benign		0.062		06/30/2014
12	209820		Cacna1c	0.727	R1889	G1	225	Y		6	118612625	R1446H	C	T	missense		Het	probably damaging	1.000	0.036	phenotype	06/30/2014
13	209862		Cadm2	0.352	R1889	G1	225	Y		16	66882795	D50G	T	C	missense		Het	probably damaging	1.000	0.200	phenotype	06/30/2014
14	209826		Ccdc81	0.172	R1889	G1	225	Y		7	89882294	Q324*	G	A	nonsense		Het	probably null		0.617		06/30/2014
15	209845		Cd300lf	0.095	R1889	G1	225	Y		11	115120380	V178A	A	G	missense		Het	probably benign	0.006	0.098	phenotype	06/30/2014
16	209833		Cdt1	0.971	R1889	G1	110	Y		8	122572052	V476A	T	C	missense		Het	possibly damaging	0.845	0.128	phenotype	06/30/2014
17	209852		Cenpj	1.000	R1889	G1	225	Y		14	56558725	V225A	A	G	missense		Het	probably benign	0.433	0.110	phenotype	06/30/2014
18	209834		Cep295	0.929	R1889	G1	225	Y		9	15332103	T1686A	T	C	missense		Het	possibly damaging	0.944	0.018		06/30/2014
19	209840		Cfap54	0.173	R1889	G1	225	Y		10	93034710	S684P	A	G	missense		Het	possibly damaging	0.939	0.036	phenotype	06/30/2014
20	209814		Clip1	0.000	R1889	G1	225	Y		5	123653496	V204F	C	A	missense		Het	probably damaging	0.994	0.034	phenotype	06/30/2014
21	209815		Cnpy4	0.145	R1889	G1	225	Y		5	138192840	E226G	A	G	missense		Het	probably benign	0.064	0.252	phenotype	06/30/2014
22	209786		Col6a3	0.000	R1889	G1	225	Y		1	90803711	M1000L	T	A	missense		Het	probably benign	0.005	0.078	phenotype	06/30/2014
23	209857		Cpsf1	0.983	R1889	G1	225	Y		15	76602156	M335V	T	C	missense		Het	probably benign	0.065	0.042	phenotype	06/30/2014
24	209798		Dnmt3b	1.000	R1889	G1	225	Y		2	153676759	A614E	C	A	missense		Het	probably benign	0.000	0.125	phenotype	06/30/2014
25	209800		Dpm1	0.385	R1889	G1	225	Y		2	168217735	R147Q	C	T	missense		Het	possibly damaging	0.669	0.043	phenotype	06/30/2014
26	265990		Dpp7	0.161	R1889	G1	225	N		2	25353679		G	T	synonymous		Het	probably null			phenotype	02/05/2015
27	209846		Engase	0.137	R1889	G1	225	Y		11	118478933	F57S	T	C	missense		Het	probably damaging	0.998	0.176	phenotype	06/30/2014
28	209789		Epb41l5	1.000	R1889	G1	225	Y		1	119549172	D718G	T	C	missense		Het	possibly damaging	0.816	0.068	phenotype	06/30/2014
29	209844		Fam20a	0.000	R1889	G1	225	Y		11	109673554	K458E	T	C	missense		Het	probably benign	0.296	0.052	phenotype	06/30/2014
30	209807		Fbxo44	0.107	R1889	G1	225	Y		4	148156269	R220S	C	G	missense		Het	probably damaging	1.000	0.272	phenotype	06/30/2014
31	209818		Gkn2	0.010	R1889	G1	225	Y		6	87378155	Y115*	T	A	nonsense		Het	probably null		0.655	phenotype	06/30/2014
32	209793		Gtdc1	0.110	R1889	G1	225	Y		2	44591914	S246P	A	G	missense		Het	probably damaging	1.000	0.234		06/30/2014
33	209865		H2-Q2	0.056	R1889	G1	225	Y		17	35345176	D302G	A	G	missense		Het	probably benign	0.237	0.062		06/30/2014
34	209823		Herc2	0.860	R1889	G1	225	Y		7	56189813	S3357L	C	T	missense		Het	possibly damaging	0.603	0.310	phenotype	06/30/2014
35	209817		Herc6	0.101	R1889	G1	225	Y		6	57662075	Y840*	T	A	nonsense		Het	probably null		0.576	phenotype	06/30/2014
36	209816		Hoxa10	0.000	R1889	G1	105	Y		6	52234492		GGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTG	small deletion		Het	probably benign			phenotype	06/30/2014
37	209819		Ift122	1.000	R1889	G1	119	Y		6	115894421		T	C	critical splice donor site	2 bp	Het	probably null		0.450	phenotype	06/30/2014
38	209835		Ilf3	1.000	R1889	G1	174	Y		9	21404767		T	A	unclassified		Het	probably benign		0.106	phenotype	06/30/2014
39	209839		Itgb2	0.420	R1889	G1	225	Y		10	77548623	N193Y	A	T	missense		Het	possibly damaging	0.744	0.184	phenotype	06/30/2014
40	209859		Itgb5	0.000	R1889	G1	225	Y		16	33910469	I65S	T	G	missense		Het	probably damaging	1.000	0.202	phenotype	06/30/2014
41	209863		Jpt2	0.093	R1889	G1	91	Y		17	24960611	M1V	T	C	start codon destroyed		Het	probably null	0.706	0.352		06/30/2014
42	209790		Kcnt2	0.338	R1889	G1	225	Y		1	140584293	H995L	A	T	missense		Het	probably damaging	0.999	0.218	phenotype	06/30/2014
43	209871		Kif20b	0.644	R1889	G1	225	Y		19	34941208		T	C	unclassified		Het	probably benign		0.115	phenotype	06/30/2014
44	209825		Kif7	1.000	R1889	G1	225	Y		7	79710463	Y342C	T	C	missense		Het	probably damaging	1.000	0.574	phenotype	06/30/2014
45	209808		Klhl21	0.294	R1889	G1	87	Y		4	152015420	V529A	T	C	missense		Het	possibly damaging	0.908	0.262		06/30/2014
46	258026		Klhl26	0.114	R1889	G1	72	Y		8	70451733	D475G	T	C	missense		Het	probably damaging	0.989	0.094		01/14/2015
47	209872		Lcor	0.312	R1889	G1	225	Y		19	41559128	Y384H	T	C	missense		Het	probably damaging	0.994	0.224	phenotype	06/30/2014
48	209792		Lrp1b	0.000	R1889	G1	225	Y		2	40919167	C2463*	A	T	nonsense		Het	probably null		0.659	phenotype	06/30/2014
49	209854		March6	0.625	R1889	G1	225	Y		15	31459193	E909G	T	C	missense		Het	possibly damaging	0.855	0.338	phenotype	06/30/2014
50	209791		Mrc1	0.051	R1889	G1	225	Y		2	14308677		A	T	critical splice acceptor site		Het	probably null		0.590	phenotype	06/30/2014
51	209842		Nipal4	0.200	R1889	G1	225	Y		11	46150733	I212F	T	A	missense		Het	probably damaging	0.994	0.106	phenotype	06/30/2014
52	209827		Nup98	1.000	R1889	G1	225	Y		7	102160716	T536S	T	A	missense		Het	probably damaging	0.999	0.278	phenotype	06/30/2014
53	209811		Nwd2	0.266	R1889	G1	225	Y		5	63807666	E1531G	A	G	missense		Het	possibly damaging	0.491	0.044		06/30/2014
54	209836		Nxpe2	0.043	R1889	G1	225	Y		9	48326614	T114A	T	C	missense		Het	probably damaging	0.994	0.046		06/30/2014
55	209861		Olfr204	0.070	R1889	G1	225	Y		16	59314963	Y148S	T	G	missense		Het	probably damaging	0.983	0.252	phenotype	06/30/2014
56	209870		Oosp1	0.228	R1889	G1	225	Y		19	11667794	V169I	C	T	missense		Het	possibly damaging	0.455	0.066		06/30/2014
57	209858		Opa1	1.000	R1889	G1	225	Y		16	29625585	V863A	T	C	missense		Het	possibly damaging	0.674	0.202	phenotype	06/30/2014
58	209802		Pabpc4l	0.117	R1889	G1	225	Y		3	46446363	M282K	A	T	missense		Het	probably benign	0.001	0.134		06/30/2014
59	209860		Parp14	0.392	R1889	G1	225	Y		16	35856760	A946V	G	A	missense		Het	probably benign	0.089	0.072	phenotype	06/30/2014
60	209869		Pcnx3	0.191	R1889	G1	225	Y		19	5672656	D1336G	T	C	missense		Het	probably damaging	1.000	0.422		06/30/2014
61	209787		Phlpp1	0.287	R1889	G1	225	Y		1	106318850	V590A	T	C	missense		Het	possibly damaging	0.948	0.144	phenotype	06/30/2014
62	209797		Rbck1	0.000	R1889	G1	163	Y		2	152318356	T468S	T	A	missense		Het	probably damaging	0.989	0.276	phenotype	06/30/2014
63	209848		Ripor2	0.223	R1889	G1	225	Y		13	24693887	I290N	T	A	missense		Het	probably damaging	1.000	0.326	phenotype	06/30/2014
64	209855		Rnf139	0.224	R1889	G1	225	Y		15	58899497	L457P	T	C	missense		Het	probably damaging	1.000	0.280	phenotype	06/30/2014
65	209847		Rtn1	0.314	R1889	G1	225	Y		12	72304410	A342S	C	A	missense		Het	possibly damaging	0.873	0.050	phenotype	06/30/2014
66	209810		Sema3d	0.000	R1889	G1	225	Y		5	12485021		A	G	splice site	4 bp	Het	probably null		0.633	phenotype	06/30/2014
67	209788		Serpinb2	0.045	R1889	G1	225	Y		1	107524607	V305D	T	A	missense		Het	probably damaging	1.000	0.388	phenotype	06/30/2014
68	209828		Sez6l2	0.000	R1889	G1	225	Y		7	126953496	V148A	T	C	missense		Het	probably damaging	0.999	0.134	phenotype	06/30/2014
69	209831		Shank2	0.000	R1889	G1	225	Y		7	144186858	S568*	C	A	nonsense		Het	probably null		0.684	phenotype	06/30/2014
70	209849		Skiv2l2	0.980	R1889	G1	191	Y		13	112887490	N707S	T	C	missense		Het	probably benign	0.001	0.094		06/30/2014
71	209812		Slc10a4	0.236	R1889	G1	225	Y		5	73012147	S372P	T	C	missense		Het	possibly damaging	0.909	0.060	phenotype	06/30/2014
72	209801		Slc10a5	0.060	R1889	G1	225	Y		3	10335490	T37A	T	C	missense		Het	probably benign	0.329	0.140		06/30/2014
73	209868		Slc14a1	0.000	R1889	G1	225	Y		18	78109697	I276V	T	C	missense		Het	possibly damaging	0.950	0.178	phenotype	06/30/2014
74	209838		Slc6a20b	0.166	R1889	G1	199	Y		9	123632204	D52E	G	T	missense		Het	probably benign	0.021	0.127		06/30/2014
75	209822		Slc6a5	1.000	R1889	G1	225	Y		7	49951434	M661T	T	C	missense		Het	probably benign	0.027	0.040	phenotype	06/30/2014
76	209843		Ssh2	0.202	R1889	G1	225	Y		11	77449745	D574E	C	G	missense		Het	probably damaging	0.999	0.218	phenotype	06/30/2014
77	209809		Steap4	0.237	R1889	G1	225	Y		5	7975892	R151L	G	T	missense		Het	probably damaging	0.999	0.272	phenotype	06/30/2014
78	209799		Sun5	0.089	R1889	G1	225	Y		2	153865995	I107L	T	A	missense		Het	probably benign	0.112	0.044		06/30/2014
79	209832		Tacc1	0.382	R1889	G1	225	Y		8	25175253	V488M	C	T	missense		Het	probably damaging	0.988	0.468	phenotype	06/30/2014
80	209804		Tgs1	1.000	R1889	G1	225	Y		4	3614928	T829A	A	G	missense		Het	probably benign	0.306	0.282	phenotype	06/30/2014
81	209864		Tnxb	0.000	R1889	G1	225	Y		17	34695825	E1929G	A	G	missense		Het	probably damaging	0.971	0.028	phenotype	06/30/2014
82	209829		Tssc4	0.073	R1889	G1	225	Y		7	143070555	Q200P	A	C	missense		Het	probably damaging	0.999	0.246	phenotype	06/30/2014
83	209794		Ttn	1.000	R1889	G1	225	Y		2	76758532	W21398R	A	G	missense		Het	probably damaging	1.000	0.366	phenotype	06/30/2014
84	209796		Usp50	0.100	R1889	G1	225	Y		2	126777898		C	T	critical splice donor site	1 bp	Het	probably null		0.448		06/30/2014
85	265991		Usp9y	0.066	R1889	G1	222	N		Y	1448829		A	T	intron	22 bp	Het	probably null			phenotype	02/05/2015
86	209821		V1rd19	0.045	R1889	G1	225	Y		7	24003207	F33I	T	A	missense		Het	probably benign	0.062	0.145		06/30/2014
87	209856		Zfat	1.000	R1889	G1	225	Y		15	68101539	T1118A	T	C	missense		Het	probably benign	0.003	0.090	phenotype	06/30/2014
[records 1 to 87 of 87]