Incidental Mutations

79 incidental mutations are currently displayed, and affect 79 genes.
16 are Possibly Damaging.
30 are Probably Damaging.
24 are Probably Benign.
9 are Probably Null.
5 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 215575 UTSW Adam25 0.098 R1933 G1 225 N 8 40754885 Y396F A T missense Het probably benign 0.014 phenotype 07/14/2014
2 215628 UTSW Adra2a 0.000 R1933 G1 225 N 19 54046406 F64L T A missense Het probably damaging 0.998 phenotype 07/14/2014
3 215533 UTSW Ankrd45 0.052 R1933 G1 225 N 1 161151300 N103I A T missense Het probably damaging 1.000 07/14/2014
4 215574 UTSW Arhgef7 0.788 R1933 G1 225 N 8 11808713 C A splice site Het probably null 0.610 phenotype 07/14/2014
5 215591 UTSW Bsn 0.287 R1933 G1 225 N 9 108116444 V703A A G missense Het possibly damaging 0.911 phenotype 07/14/2014
6 215627 UTSW Btaf1 0.947 R1933 G1 225 N 19 36972957 I529K T A missense Het probably damaging 0.998 phenotype 07/14/2014
7 215576 UTSW Ccdc110 0.067 R1933 G1 225 N 8 45943250 N726S A G missense Het probably damaging 1.000 07/14/2014
8 215623 UTSW Ccdc78 0.090 R1933 G1 225 N 17 25787070 S71T T A missense Het probably damaging 0.998 phenotype 07/14/2014
9 215616 UTSW Cct5 0.963 R1933 G1 225 N 15 31591008 Q516K G T missense Het probably benign 0.049 phenotype 07/14/2014
10 215601 UTSW Cd300c2 0.000 R1933 G1 225 N 11 115000859 V63E A T missense Het probably benign 0.217 phenotype 07/14/2014
11 215583 UTSW Cdh16 0.133 R1933 G1 225 N 8 104617963 V7A A G missense Het possibly damaging 0.706 phenotype 07/14/2014
12 215620 UTSW Clec16a 0.488 R1933 G1 225 N 16 10688539 F710L T C missense Het probably damaging 0.986 phenotype 07/14/2014
13 215566 UTSW Clpb 0.715 R1933 G1 225 N 7 101779211 F393V T G missense Het probably damaging 0.961 phenotype 07/14/2014
14 215537 UTSW Commd9 0.268 R1933 G1 225 N 2 101901031 R187H G A missense Het probably damaging 1.000 phenotype 07/14/2014
15 215562 UTSW Crx 0.302 R1933 G1 225 N 7 15868376 K126* T A nonsense Het probably null phenotype 07/14/2014
16 215617 UTSW Dcaf13 0.926 R1933 G1 225 N 15 39138088 Y264N T A missense Het probably damaging 0.991 07/14/2014
17 215610 UTSW Dnah12 0.532 R1933 G1 225 N 14 26734495 I791N T A missense Het probably damaging 0.984 07/14/2014
18 215588 UTSW Dpy19l1 0.125 R1933 G1 225 N 9 24434387 D456E A T missense Het probably damaging 0.994 07/14/2014
19 215621 UTSW Dscam 1.000 R1933 G1 225 N 16 96593214 S1963P A G missense Het probably benign 0.001 phenotype 07/14/2014
20 215564 UTSW Efl1 0.585 R1933 G1 225 N 7 82763117 Q905* C T nonsense Het probably null phenotype 07/14/2014
21 215570 UTSW Fam57b 0.198 R1933 G1 225 N 7 126827672 T A unclassified 141 bp Het probably null phenotype 07/14/2014
22 215582 UTSW Farsa 0.970 R1933 G1 225 N 8 84861151 F104L T C missense Het probably benign 0.114 phenotype 07/14/2014
23 215571 UTSW Fbxl19 0.696 R1933 G1 188 N 7 127750929 A231E C A missense Het probably benign 0.000 phenotype 07/14/2014
24 215592 UTSW Fbxw19 0.045 R1933 G1 225 N 9 109481650 N401K A T missense Het probably benign 0.196 07/14/2014
25 215558 UTSW Foxp1 1.000 R1933 G1 150 N 6 99075965 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG small deletion Het probably benign phenotype 07/14/2014
26 215580 UTSW Frem3 0.086 R1933 G1 225 N 8 80612890 N604S A G missense Het probably benign 0.001 phenotype 07/14/2014
27 215535 UTSW Gad1 1.000 R1933 G1 225 N 2 70587392 C312G T G missense Het possibly damaging 0.908 phenotype 07/14/2014
28 215549 UTSW Garem2 0.585 R1933 G1 217 N 5 30114862 E441* G T nonsense Het probably null 07/14/2014
29 215577 UTSW Glra3 0.000 R1933 G1 225 N 8 55940907 A18S G T missense Het probably benign 0.068 0.070 phenotype 07/14/2014
30 215609 UTSW Gm8206 R1933 G1 225 N 14 6022475 M8K A T missense Het probably benign 0.188 07/14/2014
31 215559 UTSW Gpr162 0.331 R1933 G1 225 N 6 124861447 S80F G A missense Het probably damaging 0.975 phenotype 07/14/2014
32 215629 UTSW Grpr 0.047 R1933 G1 222 N X 163549141 V53L C A missense Het probably benign 0.000 phenotype 07/14/2014
33 215539 UTSW Il21 0.214 R1933 G1 225 N 3 37232486 R27H C T missense Het probably benign 0.000 phenotype 07/14/2014
34 215569 UTSW Il21r 0.195 R1933 G1 225 N 7 125628981 T208I C T missense Het possibly damaging 0.917 phenotype 07/14/2014
35 215546 UTSW Kcnab2 0.523 R1933 G1 225 N 4 152435866 T6A T C missense Het possibly damaging 0.659 phenotype 07/14/2014
36 215561 UTSW Klra4 0.058 R1933 G1 225 N 6 130065244 Q20L T A missense Het possibly damaging 0.833 07/14/2014
37 215554 UTSW Lrrtm1 0.000 R1933 G1 225 N 6 77244966 A T intron Het probably null phenotype 07/14/2014
38 215595 UTSW Lrrtm3 0.321 R1933 G1 225 N 10 64088513 F292L A G missense Het possibly damaging 0.808 07/14/2014
39 215626 UTSW Mpeg1 0.100 R1933 G1 225 N 19 12462647 K490* A T nonsense Het probably null 07/14/2014
40 215563 UTSW Myh14 0.000 R1933 G1 174 N 7 44615348 M1671I C T missense Het probably benign 0.092 phenotype 07/14/2014
41 215534 UTSW Nebl 0.289 R1933 G1 225 N 2 17375292 M757K A T missense Het probably damaging 0.970 07/14/2014
42 215536 UTSW Olfr1110 0.086 R1933 G1 225 N 2 87135844 H159L T A missense Het probably damaging 0.997 phenotype 07/14/2014
43 215568 UTSW Olfr504 0.047 R1933 G1 225 N 7 108565523 F91V A C missense Het possibly damaging 0.569 phenotype 07/14/2014
44 215567 UTSW Olfr631 0.089 R1933 G1 225 N 7 103929130 M102I G T missense Het probably damaging 0.991 phenotype 07/14/2014
45 215618 UTSW Pkhd1l1 0.234 R1933 G1 225 N 15 44540884 H2303L A T missense Het possibly damaging 0.481 07/14/2014
46 215557 UTSW Podxl2 0.171 R1933 G1 225 N 6 88849605 V240M C T missense Het probably benign 0.052 phenotype 07/14/2014
47 215603 UTSW Ppp2r5e 0.321 R1933 G1 225 N 12 75469567 A239P C G missense Het probably damaging 0.997 0.272 phenotype 07/14/2014
48 215572 UTSW Prss53 0.489 R1933 G1 225 N 7 127886262 *553W T C makesense Het probably null 07/14/2014
49 215602 UTSW Psma3 0.925 R1933 G1 225 N 12 70984694 M43K T A missense Het probably benign 0.216 phenotype 07/14/2014
50 215598 UTSW Rad50 1.000 R1933 G1 225 N 11 53680061 T790K G T missense Het probably benign 0.163 phenotype 07/14/2014
51 215590 UTSW Rasgrf1 0.000 R1933 G1 225 N 9 89953913 Q231H G T missense Het probably damaging 0.979 0.084 phenotype 07/14/2014
52 215556 UTSW Rpn1 0.942 R1933 G1 225 N 6 88093859 V237E T A missense Het probably damaging 1.000 phenotype 07/14/2014
53 215593 UTSW Scn10a 0.379 R1933 G1 225 N 9 119609998 M1601L T A missense Het probably damaging 1.000 phenotype 07/14/2014
54 215555 UTSW Sema4f 0.000 R1933 G1 225 N 6 82930927 P180Q G T missense Het probably damaging 1.000 phenotype 07/14/2014
55 215532 UTSW Serpinb5 0.705 R1933 G1 225 N 1 106876121 E8G A G missense Het probably damaging 0.988 phenotype 07/14/2014
56 215615 UTSW Sgcg 0.223 R1933 G1 225 N 14 61232412 V167I C T missense Het possibly damaging 0.771 phenotype 07/14/2014
57 215552 UTSW Slc25a13 0.374 R1933 G1 225 N 6 6109262 V367M C T missense Het probably damaging 1.000 phenotype 07/14/2014
58 215607 UTSW Spata31 0.342 R1933 G1 225 N 13 64920610 S191P T C missense Het probably benign 0.022 07/14/2014
59 215624 UTSW Srbd1 0.963 R1933 G1 225 N 17 86102893 V537A A G missense Het probably damaging 0.998 07/14/2014
60 215597 UTSW Srgap1 0.232 R1933 G1 225 N 10 121925903 D113E G T missense Het possibly damaging 0.888 phenotype 07/14/2014
61 215619 UTSW Srl 0.107 R1933 G1 225 N 16 4492350 I505T A G missense Het probably damaging 0.991 phenotype 07/14/2014
62 215589 UTSW St14 1.000 R1933 G1 217 N 9 31106212 T226I G A missense Het probably benign 0.002 phenotype 07/14/2014
63 215538 UTSW Stard9 0.275 R1933 G1 225 N 2 120698656 I1798N T A missense Het possibly damaging 0.547 07/14/2014
64 215579 UTSW Sugp1 0.948 R1933 G1 225 N 8 70056575 E166G A G missense Het possibly damaging 0.924 phenotype 07/14/2014
65 215541 UTSW Susd1 0.155 R1933 G1 225 N 4 59351695 N455K A T missense Het possibly damaging 0.719 07/14/2014
66 215622 UTSW Sytl3 0.132 R1933 G1 225 N 17 6733046 V205E T A missense Het probably damaging 1.000 phenotype 07/14/2014
67 215565 UTSW Tenm4 1.000 R1933 G1 225 N 7 96895326 Y2183C A G missense Het probably damaging 1.000 phenotype 07/14/2014
68 215578 UTSW Tktl2 0.400 R1933 G1 225 N 8 66512347 V186M G A missense Het probably damaging 0.978 0.206 07/14/2014
69 215550 UTSW Tlr1 0.000 R1933 G1 225 N 5 64925438 T599P T G missense Het possibly damaging 0.937 phenotype 07/14/2014
70 215586 UTSW Trpc6 0.000 R1933 G1 225 N 9 8656545 D658N G A missense Het probably damaging 0.999 phenotype 07/14/2014
71 215543 UTSW Ttc39b 0.120 R1933 G1 225 N 4 83232720 V546A A G missense Het possibly damaging 0.870 07/14/2014
72 215548 UTSW Ube3c 0.399 R1933 G1 225 N 5 29619659 Y561H T C missense Het probably damaging 0.969 07/14/2014
73 215553 UTSW Vmn1r29 0.061 R1933 G1 225 N 6 58307420 S42T T A missense Het probably benign 0.033 07/14/2014
74 215585 UTSW Vps4a 0.629 R1933 G1 225 N 8 107044558 V392A T C missense Het probably benign 0.209 phenotype 07/14/2014
75 215612 UTSW Wdfy4 0.000 R1933 G1 225 N 14 33133344 E771G T C missense Het probably benign 0.080 07/14/2014
76 215542 UTSW Whrn 0.000 R1933 G1 225 N 4 63415639 Q415* G A nonsense Het probably null 0.646 phenotype 07/14/2014
77 215611 UTSW Wnt5a 1.000 R1933 G1 225 N 14 28511845 P10L C T missense Het probably benign 0.001 phenotype 07/14/2014
78 215614 UTSW Zfhx2 0.204 R1933 G1 225 N 14 55075238 T C start gained Het probably benign 07/14/2014
79 215531 UTSW Zfp451 0.278 R1933 G1 225 N 1 33777822 K132R T C missense Het probably damaging 0.999 07/14/2014
[records 1 to 79 of 79]