Incidental Mutations

81 incidental mutations are currently displayed, and affect 81 genes.
12 are Possibly Damaging.
30 are Probably Damaging.
32 are Probably Benign.
6 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 81 of 81] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 222425 UTSW 4930415L06Rik 0.222 R1981 G1 222 Y X 89931445 V382E A T missense Het probably damaging 0.998 0.046 08/25/2014
2 222399 UTSW Anks1 0.000 R1981 G1 225 Y 17 27985121 V181A T C missense Het probably damaging 0.999 0.184 phenotype 08/25/2014
3 222409 UTSW Aqp4 0.148 R1981 G1 225 Y 18 15393551 D291G T C missense Het probably damaging 0.980 0.092 phenotype 08/25/2014
4 222415 UTSW Atad1 0.297 R1981 G1 225 Y 19 32695810 D224E G T missense Het probably benign 0.003 0.128 phenotype 08/25/2014
5 222309 UTSW Atp1a3 1.000 R1981 G1 225 Y 7 25000975 E33A T G missense Het probably benign 0.189 0.216 phenotype 08/25/2014
6 222252 UTSW Baz2b 0.207 R1981 G1 225 Y 2 59923680 F1100L A G missense Het possibly damaging 0.953 0.408 phenotype 08/25/2014
7 222327 UTSW Car7 0.000 R1981 G1 225 Y 8 104548377 C T splice site Het probably benign phenotype 08/25/2014
8 266029 UTSW Casp8 1.000 R1981 G1 225 N 1 58828962 C A synonymous Het probably null phenotype 02/05/2015
9 222355 UTSW Cdh23 0.406 R1981 G1 225 Y 10 60378751 L1495H A T missense Het probably damaging 1.000 0.432 phenotype 08/25/2014
10 222305 UTSW Ceacam9 0.000 R1981 G1 225 Y 7 16725307 L177R T G missense Het probably benign 0.159 0.123 phenotype 08/25/2014
11 222276 UTSW Col16a1 0.102 R1981 G1 225 Y 4 130065443 P346A C G missense Het unknown 0.090 phenotype 08/25/2014
12 222417 UTSW Cyp2c29 0.079 R1981 G1 225 Y 19 39307772 A G splice site 4 bp Het probably null 0.635 08/25/2014
13 222288 UTSW Cyp3a13 0.000 R1981 G1 225 Y 5 137911856 S139G T C missense Het probably damaging 0.970 0.286 phenotype 08/25/2014
14 222344 UTSW Dapk2 0.000 R1981 G1 225 Y 9 66268898 H327R A G missense Het probably benign 0.001 0.064 phenotype 08/25/2014
15 222329 UTSW Ddx19b 0.000 R1981 G1 225 Y 8 111009343 T357A T C missense Het possibly damaging 0.879 0.404 phenotype 08/25/2014
16 222367 UTSW Dnah2 0.000 R1981 G1 225 Y 11 69474325 Y1944H A G missense Het probably damaging 1.000 0.408 phenotype 08/25/2014
17 222379 UTSW Dnaic2 0.096 R1981 G1 204 Y 11 114732929 V6E T A missense Het probably damaging 0.996 0.314 phenotype 08/25/2014
18 222381 UTSW Eipr1 1.000 R1981 G1 225 Y 12 28863025 Y242H T C missense Het probably damaging 1.000 0.260 phenotype 08/25/2014
19 222321 UTSW Fam149a 0.000 R1981 G1 225 Y 8 45381741 D7A T G missense Het probably damaging 0.999 0.232 08/25/2014
20 222383 UTSW Fam217a 0.113 R1981 G1 225 Y 13 34916754 D140V T A missense Het probably benign 0.071 08/25/2014
21 222266 UTSW Fat4 1.000 R1981 G1 225 Y 3 38991664 C3944Y G A missense Het probably damaging 1.000 0.430 phenotype 08/25/2014
22 222387 UTSW Fezf2 0.861 R1981 G1 225 Y 14 12344405 P261T G T missense Het probably benign 0.039 0.198 phenotype 08/25/2014
23 222393 UTSW Gcsam 0.055 R1981 G1 225 Y 16 45619974 T127S A T missense Het probably damaging 0.995 0.226 phenotype 08/25/2014
24 222284 UTSW Git2 0.275 R1981 G1 223 Y 5 114749559 C T splice site Het probably benign phenotype 08/25/2014
25 222264 UTSW Gm1527 0.058 R1981 G1 160 Y 3 28915835 T C critical splice donor site 2 bp Het probably null 0.468 08/25/2014
26 222401 UTSW Gm7030 0.112 R1981 G1 225 Y 17 36128722 D122V T A missense Het probably damaging 0.990 0.028 08/25/2014
27 222319 UTSW Gtf3c1 1.000 R1981 G1 225 Y 7 125644272 L1720P A G missense Het possibly damaging 0.956 0.050 phenotype 08/25/2014
28 222256 UTSW Hat1 0.950 R1981 G1 225 Y 2 71389977 T28A A G missense Het probably benign 0.007 0.118 phenotype 08/25/2014
29 222397 UTSW Igf2r 0.921 R1981 G1 225 Y 17 12733903 Q219* G A nonsense Het probably null 0.646 phenotype 08/25/2014
30 222290 UTSW Impdh1 0.311 R1981 G1 225 Y 6 29206451 D129V T A missense Het possibly damaging 0.704 0.394 phenotype 08/25/2014
31 222403 UTSW Kcnh8 0.000 R1981 G1 217 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.131 phenotype 08/25/2014
32 222411 UTSW Ltbp3 0.282 R1981 G1 148 Y 19 5758079 Q1250R A G missense Het probably benign 0.147 0.094 phenotype 08/25/2014
33 222299 UTSW Mansc4 0.081 R1981 G1 225 Y 6 147075675 I148F T A missense Het probably benign 0.448 0.054 08/25/2014
34 222274 UTSW Mast2 0.000 R1981 G1 225 Y 4 116314840 Y569C T C missense Het probably damaging 1.000 0.410 phenotype 08/25/2014
35 222272 UTSW Mcoln3 0.116 R1981 G1 225 Y 3 146140590 K552* A T nonsense Het probably null 0.594 phenotype 08/25/2014
36 222315 UTSW Mctp2 0.149 R1981 G1 225 Y 7 72164698 Q601R T C missense Het probably benign 0.007 0.046 08/25/2014
37 222391 UTSW Mei1 0.333 R1981 G1 225 Y 15 82103312 N859S A G missense Het probably benign 0.001 0.113 phenotype 08/25/2014
38 222373 UTSW Myo19 0.139 R1981 G1 225 Y 11 84892170 Q170L A T missense Het possibly damaging 0.456 0.204 08/25/2014
39 222282 UTSW Myo1h 1.000 R1981 G1 225 Y 5 114353837 F676S T C missense Het probably damaging 1.000 0.522 08/25/2014
40 222340 UTSW Myo9a 0.000 R1981 G1 225 Y 9 59894146 T1876A A G missense Het probably benign 0.000 0.116 phenotype 08/25/2014
41 222361 UTSW Nav3 0.000 R1981 G1 225 Y 10 109719090 G T splice site Het probably benign phenotype 08/25/2014
42 222250 UTSW Ndor1 0.926 R1981 G1 206 Y 2 25255224 Y43C T C missense Het probably damaging 0.974 0.502 phenotype 08/25/2014
43 222371 UTSW Nlrp1a 0.121 R1981 G1 225 Y 11 71098938 V1102A A G missense Het probably damaging 0.995 0.027 phenotype 08/25/2014
44 222346 UTSW Nmnat3 0.075 R1981 G1 225 Y 9 98410299 I199T T C missense Het possibly damaging 0.925 0.214 phenotype 08/25/2014
45 222280 UTSW Nsun7 0.000 R1981 G1 225 Y 5 66261214 S96P T C missense Het probably damaging 0.989 0.082 phenotype 08/25/2014
46 222270 UTSW Ntng1 0.000 R1981 G1 225 Y 3 109935010 V149A A G missense Het possibly damaging 0.607 0.066 phenotype 08/25/2014
47 222286 UTSW Oas3 0.077 R1981 G1 225 Y 5 120761835 T C splice site Het probably benign phenotype 08/25/2014
48 222258 UTSW Olfr1055 0.054 R1981 G1 225 Y 2 86347142 I208N A T missense Het possibly damaging 0.936 0.073 phenotype 08/25/2014
49 222262 UTSW Olfr1297 0.092 R1981 G1 225 Y 2 111621241 I278F T A missense Het probably benign 0.003 0.114 phenotype 08/25/2014
50 222303 UTSW Olfr1350 0.076 R1981 G1 225 Y 7 6570558 D189G A G missense Het probably benign 0.014 0.304 phenotype 08/25/2014
51 222413 UTSW Olfr1418 0.060 R1981 G1 225 Y 19 11855007 Q315H T G missense Het possibly damaging 0.648 0.049 phenotype 08/25/2014
52 222338 UTSW Olfr147 0.056 R1981 G1 225 Y 9 38403735 L287P T C missense Het probably damaging 0.991 0.346 phenotype 08/25/2014
53 222301 UTSW Olfr5 0.137 R1981 G1 225 Y 7 6480932 M75V T C missense Het probably benign 0.292 0.124 phenotype 08/25/2014
54 222419 UTSW Pax2 1.000 R1981 G1 225 Y 19 44818465 D301N G A missense Het probably damaging 0.999 0.156 phenotype 08/25/2014
55 222357 UTSW Pcsk4 0.000 R1981 G1 225 Y 10 80325779 E176V T A missense Het probably damaging 1.000 0.170 phenotype 08/25/2014
56 222248 UTSW Pkhd1 0.105 R1981 G1 225 Y 1 20117060 P3675S G A missense Het probably benign 0.003 0.112 phenotype 08/25/2014
57 222342 UTSW Plekho2 0.095 R1981 G1 225 Y 9 65558692 L138Q A T missense Het probably damaging 1.000 0.332 08/25/2014
58 222334 UTSW Prkcsh 1.000 R1981 G1 211 Y 9 22012868 D458G A G missense Het probably damaging 0.991 0.230 phenotype 08/25/2014
59 222377 UTSW Prr11 0.076 R1981 G1 225 Y 11 87103290 D100V T A missense Het probably damaging 0.988 0.344 08/25/2014
60 222353 UTSW Qars 0.953 R1981 G1 225 Y 9 108515028 N136D A G missense Het probably damaging 0.999 0.404 08/25/2014
61 222351 UTSW Rbm15b 0.303 R1981 G1 225 Y 9 106881623 A G unclassified Het probably benign 0.054 phenotype 08/25/2014
62 222365 UTSW Rel 0.000 R1981 G1 225 Y 11 23742761 G424D C T missense Het probably benign 0.000 0.111 phenotype 08/25/2014
63 222268 UTSW Rsrc1 0.114 R1981 G1 225 Y 3 67350005 D250G A G missense Het probably benign 0.179 0.119 phenotype 08/25/2014
64 222423 UTSW Samt3 0.027 R1981 G1 222 Y X 86047134 M211L A C missense Het probably benign 0.008 0.118 08/25/2014
65 222254 UTSW Scn2a 1.000 R1981 G1 225 Y 2 65690170 N503K C A missense Het probably damaging 0.999 0.224 phenotype 08/25/2014
66 222295 UTSW Sh2d6 0.055 R1981 G1 225 Y 6 72517544 G A splice site Het probably benign 08/25/2014
67 222375 UTSW Smg8 0.399 R1981 G1 225 Y 11 87085331 T475A T C missense Het probably benign 0.001 0.088 08/25/2014
68 222421 UTSW Ssxb10 0.027 R1981 G1 222 Y X 8331019 D77G A G missense Het probably benign 0.002 0.116 08/25/2014
69 222336 UTSW Tbx20 1.000 R1981 G1 225 Y 9 24770913 K48N T A missense Het possibly damaging 0.848 0.058 phenotype 08/25/2014
70 222317 UTSW Tead1 1.000 R1981 G1 225 Y 7 112891745 D231E C A missense Het probably benign 0.033 0.162 phenotype 08/25/2014
71 222405 UTSW Ticam1 0.000 R1981 G1 225 Y 17 56271555 R180H C T missense Het probably damaging 0.993 0.102 phenotype 08/25/2014
72 222313 UTSW Tjp1 1.000 R1981 G1 225 Y 7 65312855 F1111L A T missense Het probably damaging 0.991 0.022 phenotype 08/25/2014
73 222389 UTSW Tlr11 0.000 R1981 G1 225 Y 14 50361988 I477K T A missense Het possibly damaging 0.953 0.040 08/25/2014
74 222332 UTSW Ttc13 0.000 R1981 G1 225 Y 8 124714187 A G critical splice donor site 2 bp Het probably null 0.466 08/25/2014
75 222260 UTSW Ttc17 0.610 R1981 G1 225 Y 2 94326704 N411S T C missense Het possibly damaging 0.819 0.462 08/25/2014
76 222363 UTSW Usp15 0.000 R1981 G1 225 Y 10 123125041 T A splice site Het probably benign phenotype 08/25/2014
77 222297 UTSW Usp18 0.157 R1981 G1 225 Y 6 121252517 K32E A G missense Het probably benign 0.081 0.065 phenotype 08/25/2014
78 222293 UTSW Vmn1r12 0.173 R1981 G1 225 Y 6 57159661 M248L A T missense Het probably benign 0.026 0.160 08/25/2014
79 222407 UTSW Zbtb14 0.823 R1981 G1 225 Y 17 69388502 F398L C A missense Het probably damaging 1.000 0.032 phenotype 08/25/2014
80 222323 UTSW Zfp930 0.000 R1981 G1 225 Y 8 69228172 L172H T A missense Het probably damaging 1.000 0.029 08/25/2014
81 222311 UTSW Zfp976 0.090 R1981 G1 225 Y 7 42613622 H264Y G A missense Het probably damaging 0.987 0.288 08/25/2014
[records 1 to 81 of 81]