Incidental Mutations

83 incidental mutations are currently displayed, and affect 83 genes.
10 are Possibly Damaging.
33 are Probably Damaging.
28 are Probably Benign.
11 are Probably Null.
1 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 83 of 83] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 222974 UTSW 1700025C18Rik R2016 G1 225 N 2 165079026 D29G T C missense Het unknown 08/25/2014
2 223058 UTSW Abca13 0.000 R2016 G1 225 N 11 9290619 L827F A T missense Het probably damaging 1.000 phenotype 08/25/2014
3 223070 UTSW Abca8a 0.087 R2016 G1 225 N 11 110070387 F570L A G missense Het probably damaging 0.992 08/25/2014
4 223074 UTSW Adck1 0.000 R2016 G1 225 N 12 88461092 I493N T A missense Het probably damaging 0.999 08/25/2014
5 222994 UTSW Adra2c 0.377 R2016 G1 225 N 5 35280312 C143R T C missense Het probably damaging 1.000 phenotype 08/25/2014
6 223014 UTSW Akap13 1.000 R2016 G1 225 N 7 75704531 T1800M C T missense Het probably damaging 0.992 phenotype 08/25/2014
7 223030 UTSW Angpt2 0.924 R2016 G1 225 N 8 18705731 N240S T C missense Het probably damaging 0.960 phenotype 08/25/2014
8 223072 UTSW Apob 0.900 R2016 G1 225 N 12 8007751 D2078N G A missense Het possibly damaging 0.483 phenotype 08/25/2014
9 223116 UTSW Atp8b1 0.000 R2016 G1 225 N 18 64540334 N989S T C missense Het probably damaging 1.000 phenotype 08/25/2014
10 223060 UTSW B3gnt2 0.951 R2016 G1 225 N 11 22836621 D189G T C missense Het probably damaging 1.000 phenotype 08/25/2014
11 223010 UTSW Bcam 0.000 R2016 G1 225 N 7 19760349 T374M G A missense Het probably benign 0.385 phenotype 08/25/2014
12 223016 UTSW Blm 1.000 R2016 G1 225 N 7 80505926 D335G T C missense Het probably benign 0.259 phenotype 08/25/2014
13 222969 UTSW Cbfa2t2 0.698 R2016 G1 225 N 2 154517807 L264P T C missense Het probably damaging 0.998 phenotype 08/25/2014
14 223028 UTSW Col4a2 1.000 R2016 G1 225 N 8 11445086 F1515L T C missense Het probably benign 0.035 phenotype 08/25/2014
15 223132 UTSW Csf2ra 0.082 R2016 G1 108 N 19 61226893 M95L T G missense Het probably benign 0.015 phenotype 08/25/2014
16 223130 UTSW Cyp2c70 0.091 R2016 G1 225 N 19 40164412 T300S T A missense Het possibly damaging 0.936 08/25/2014
17 223109 UTSW Cyp4f15 0.463 R2016 G1 225 N 17 32702159 H440L A T missense Het probably damaging 0.999 phenotype 08/25/2014
18 223038 UTSW Dcaf1 1.000 R2016 G1 225 N 9 106839088 D360E T A missense Het probably benign 0.406 phenotype 08/25/2014
19 222945 UTSW Ddr2 0.000 R2016 G1 225 N 1 169984968 M652V T C missense Het probably damaging 0.999 phenotype 08/25/2014
20 223066 UTSW Dnah2 0.000 R2016 G1 225 N 11 69437070 I3370F T A missense Het probably damaging 0.972 phenotype 08/25/2014
21 222992 UTSW Dpysl5 0.359 R2016 G1 225 N 5 30791597 D399N G A missense Het probably damaging 1.000 0.348 phenotype 08/25/2014
22 223062 UTSW Efemp1 0.000 R2016 G1 225 N 11 28921613 R376L G T missense Het probably damaging 0.997 phenotype 08/25/2014
23 223018 UTSW Efl1 0.329 R2016 G1 225 N 7 82753709 D673A A C missense Het probably damaging 1.000 phenotype 08/25/2014
24 222962 UTSW Eid1 0.395 R2016 G1 225 N 2 125673201 M4V A G missense Het probably benign 0.014 08/25/2014
25 223013 UTSW Emc10 0.000 R2016 G1 166 N 7 44493192 R109W G A missense Het probably damaging 1.000 0.216 phenotype 08/25/2014
26 222972 UTSW Emilin3 0.000 R2016 G1 225 N 2 160909610 R170C G A missense Het possibly damaging 0.846 08/25/2014
27 223086 UTSW Erap1 0.202 R2016 G1 225 N 13 74664151 W362R T C missense Het probably damaging 1.000 phenotype 08/25/2014
28 223079 UTSW Fam208b 0.120 R2016 G1 225 N 13 3576770 I1060K A T missense Het probably benign 0.413 08/25/2014
29 223107 UTSW Fam234a 0.086 R2016 G1 225 N 17 26218316 F91L A G missense Het probably benign 0.070 08/25/2014
30 223008 UTSW Fam71e2 0.086 R2016 G1 225 N 7 4759398 I244N A T missense Het probably damaging 0.997 08/25/2014
31 223004 UTSW Flnc 1.000 R2016 G1 225 N 6 29443797 G A critical splice donor site 1 bp Het probably null phenotype 08/25/2014
32 222951 UTSW Fsip2 0.137 R2016 G1 225 N 2 82982732 K3132E A G missense Het possibly damaging 0.528 phenotype 08/25/2014
34 223091 UTSW Gnl3 1.000 R2016 G1 225 N 14 31016369 A G unclassified Het probably null phenotype 08/25/2014
35 223105 UTSW Has1 0.000 R2016 G1 225 N 17 17848270 I274N A T missense Het probably damaging 0.999 phenotype 08/25/2014
36 223103 UTSW Itsn1 0.000 R2016 G1 225 N 16 91905501 T C critical splice donor site 2 bp Het probably null phenotype 08/25/2014
37 223113 UTSW Kcnh8 0.000 R2016 G1 184 N 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.131 phenotype 08/25/2014
38 223085 UTSW Kif13a 0.542 R2016 G1 225 N 13 46810799 D475G T C missense Het probably benign 0.134 phenotype 08/25/2014
39 222943 UTSW Klhl20 0.180 R2016 G1 225 N 1 161103038 M298K A T missense Het probably damaging 0.977 phenotype 08/25/2014
40 222946 UTSW Kynu 0.000 R2016 G1 225 N 2 43604277 G241* G T nonsense Het probably null phenotype 08/25/2014
41 222984 UTSW Lrif1 0.081 R2016 G1 225 N 3 106732206 L202F G T missense Het possibly damaging 0.936 08/25/2014
42 223118 UTSW Lrp5 0.928 R2016 G1 194 N 19 3610056 K1003E T C missense Het probably benign 0.041 phenotype 08/25/2014
43 223128 UTSW Mamdc2 0.163 R2016 G1 225 N 19 23334029 D487G T C missense Het probably damaging 0.978 08/25/2014
44 222956 UTSW Mapk8ip1 0.382 R2016 G1 225 N 2 92391034 A G critical splice donor site 2 bp Het probably null phenotype 08/25/2014
45 223054 UTSW Mettl25 0.121 R2016 G1 225 N 10 105797306 E425D T A missense Het probably benign 0.003 08/25/2014
46 223048 UTSW Midn 0.193 R2016 G1 136 N 10 80150115 R13L G T missense Het possibly damaging 0.906 phenotype 08/25/2014
47 223095 UTSW Mtmr9 0.358 R2016 G1 225 N 14 63540264 Y136C T C missense Het possibly damaging 0.588 phenotype 08/25/2014
48 223101 UTSW Mylk 0.000 R2016 G1 225 N 16 34996817 V61M G A missense Het probably damaging 0.999 phenotype 08/25/2014
49 223099 UTSW Nalcn 1.000 R2016 G1 225 N 14 123594581 T C splice site Het probably null phenotype 08/25/2014
50 223068 UTSW Nle1 1.000 R2016 G1 225 N 11 82905547 P166Q G T missense Het probably damaging 1.000 phenotype 08/25/2014
51 222988 UTSW Nr4a3 1.000 R2016 G1 225 N 4 48083252 C595Y G A missense Het probably damaging 1.000 phenotype 08/25/2014
52 222952 UTSW Olfr1133 0.060 R2016 G1 225 N 2 87646052 V24M C T missense Het probably benign 0.182 phenotype 08/25/2014
53 222960 UTSW Olfr1288 0.071 R2016 G1 225 N 2 111479187 M134I G T missense Het probably benign 0.001 phenotype 08/25/2014
54 223093 UTSW Olfr724 0.234 R2016 G1 127 N 14 49960502 I190T A G missense Het probably benign 0.001 phenotype 08/25/2014
55 266043 UTSW Olfr906 0.056 R2016 G1 225 N 9 38488013 A T critical splice acceptor site Het probably null phenotype 02/05/2015
56 223035 UTSW Olfr963 0.071 R2016 G1 225 N 9 39669555 Y166C A G missense Het probably damaging 1.000 phenotype 08/25/2014
57 222998 UTSW Pds5a 1.000 R2016 G1 225 N 5 65648007 T A critical splice acceptor site Het probably null phenotype 08/25/2014
58 223120 UTSW Pitpnm1 0.000 R2016 G1 225 N 19 4111873 V955A T C missense Het probably benign 0.248 phenotype 08/25/2014
59 222964 UTSW Plcb1 0.318 R2016 G1 225 N 2 135362420 I898N T A missense Het possibly damaging 0.937 phenotype 08/25/2014
60 223111 UTSW Plcl2 0.268 R2016 G1 225 N 17 50606694 V244M G A missense Het probably damaging 1.000 phenotype 08/25/2014
61 223025 UTSW Plk1 1.000 R2016 G1 225 N 7 122162440 K257R A G missense Het probably damaging 0.998 phenotype 08/25/2014
62 223006 UTSW Prkcg 0.000 R2016 G1 225 N 7 3323550 T460S A T missense Het probably damaging 0.977 phenotype 08/25/2014
63 223082 UTSW Prl7d1 0.000 R2016 G1 225 N 13 27710173 H138Y G A missense Het probably damaging 0.996 08/25/2014
64 223036 UTSW Prss35 0.115 R2016 G1 225 N 9 86755512 S112G A G missense Het probably benign 0.366 08/25/2014
65 222954 UTSW Ptprj 0.330 R2016 G1 225 N 2 90464614 V417M C T missense Het probably damaging 1.000 phenotype 08/25/2014
66 223027 UTSW Pwwp2b 0.093 R2016 G1 225 N 7 139256151 I503F A T missense Het possibly damaging 0.912 08/25/2014
67 223122 UTSW Rasgrp2 0.000 R2016 G1 225 N 19 6413165 V498A T C missense Het probably benign 0.006 phenotype 08/25/2014
68 223032 UTSW Sall1 0.940 R2016 G1 225 N 8 89028409 V1314A A G missense Het probably benign 0.097 phenotype 08/25/2014
69 222982 UTSW Sema6c 0.379 R2016 G1 225 N 3 95171234 I549V A G missense Het probably benign 0.001 phenotype 08/25/2014
70 223081 UTSW Slc17a1 0.060 R2016 G1 225 N 13 23878539 S230G A G missense Het probably benign 0.034 08/25/2014
71 223046 UTSW Slc5a4a 0.078 R2016 G1 225 N 10 76153580 F106V T G missense Het probably benign 0.003 08/25/2014
72 222976 UTSW Spata5 1.000 R2016 G1 225 N 3 37578762 V839A T C missense Het possibly damaging 0.484 phenotype 08/25/2014
73 223056 UTSW Stat6 0.777 R2016 G1 225 N 10 127650796 L147P T C missense Het probably damaging 1.000 phenotype 08/25/2014
74 223044 UTSW Taar7d 0.165 R2016 G1 225 N 10 24027744 S175T T A missense Het probably benign 0.113 08/25/2014
75 223000 UTSW Tmem132b 0.113 R2016 G1 225 N 5 125623016 Q206R A G missense Het probably benign 0.000 08/25/2014
76 223002 UTSW Tmem229a 0.067 R2016 G1 225 N 6 24955062 D231G T C missense Het probably benign 0.002 08/25/2014
77 223023 UTSW Trim66 0.229 R2016 G1 225 N 7 109472232 A G critical splice donor site 2 bp Het probably null 08/25/2014
78 222949 UTSW Ttc30a1 0.198 R2016 G1 225 N 2 75981457 L94P A G missense Het probably benign 0.416 08/25/2014
79 222966 UTSW Ttll9 0.067 R2016 G1 190 N 2 153002294 E374V A T missense Het probably damaging 0.997 08/25/2014
80 223021 UTSW Vmn2r69 0.081 R2016 G1 225 N 7 85407285 D548E A T missense Het probably damaging 0.984 08/25/2014
81 222941 UTSW Zcchc2 0.282 R2016 G1 225 N 1 106004121 T A unclassified Het probably null 08/25/2014
82 266042 UTSW Zfp282 0.085 R2016 G1 225 N 6 47897787 T A intron Het probably null 02/05/2015
83 222990 UTSW Zfp352 0.000 R2016 G1 225 N 4 90225171 E516G A G missense Het probably benign 0.422 08/25/2014
[records 1 to 83 of 83]