Incidental Mutations

98 incidental mutations are currently displayed, and affect 96 genes.
17 are Possibly Damaging.
30 are Probably Damaging.
36 are Probably Benign.
13 are Probably Null.
3 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 98 of 98] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 227984 UTSW 2010111I01Rik 0.192 R2130 G1 225 Y 13 63210149 C656S T A missense Het probably benign 0.001 0.056 phenotype 09/17/2014
2 227952 UTSW 9030624J02Rik 0.164 R2130 G1 225 Y 7 118794575 Y516H T C missense Het probably damaging 1.000 0.230 09/17/2014
3 227948 UTSW A2ml1 0.220 R2130 G1 225 Y 6 128576260 N178I T A missense Het probably damaging 0.996 0.034 09/17/2014
4 227928 UTSW Adgrl2 1.000 R2130 G1 225 Y 3 148890488 I71V T C missense Het probably damaging 0.989 0.318 phenotype 09/17/2014
5 227986 UTSW Adgrv1 0.000 R2130 G1 225 Y 13 81581727 T212A T C missense Het possibly damaging 0.611 0.098 phenotype 09/17/2014
6 227895 UTSW Aox3 0.000 R2130 G1 225 Y 1 58169843 H845R A G missense Het probably damaging 0.998 0.039 09/17/2014
7 227965 UTSW Apaf1 1.000 R2130 G1 225 Y 10 91060165 Y348* A T nonsense Het probably null 0.636 phenotype 09/17/2014
8 227954 UTSW Apobr 0.076 R2130 G1 225 Y 7 126587206 T630A A G missense Het probably benign 0.147 0.065 phenotype 09/17/2014
9 227976 UTSW Arhgap23 0.243 R2130 G1 206 Y 11 97451561 D223G A G missense Het possibly damaging 0.771 0.056 phenotype 09/17/2014
10 227996 UTSW Asic1 0.196 R2130 G1 225 Y 15 99671875 T26S A T missense Het possibly damaging 0.732 0.058 phenotype 09/17/2014
11 227932 UTSW Atp13a2 0.000 R2130 G1 225 Y 4 141005016 M864K T A missense Het probably damaging 0.988 0.430 phenotype 09/17/2014
12 228000 UTSW Atrnl1 0.304 R2130 G1 225 Y 19 57654994 G438D G A missense Het probably damaging 0.997 0.230 phenotype 09/17/2014
13 277481 UTSW Bbc3 0.000 R2130 G1 38 Y 7 16312343 V68A T C missense Het possibly damaging 0.511 0.186 phenotype 04/10/2015
14 227997 UTSW Birc6 1.000 R2130 G1 225 Y 17 74659154 T C splice site Het probably benign phenotype 09/17/2014
15 227969 UTSW Btnl9 0.073 R2130 G1 225 Y 11 49180696 F100S A G missense Het probably damaging 0.994 0.294 09/17/2014
16 227962 UTSW Ccpg1 0.362 R2130 G1 225 Y 9 73013158 N685S A G missense Het probably damaging 0.975 0.238 09/17/2014
17 227957 UTSW Ces3b 0.011 R2130 G1 225 Y 8 105092975 T A critical splice donor site 2 bp Het probably null 0.694 09/17/2014
18 227910 UTSW Cfhr2 0.058 R2130 G1 117 N 1 139831155 R52S T G missense Het probably benign 0.413 0.122 09/17/2014
19 227967 UTSW Clhc1 0.050 R2130 G1 225 Y 11 29557663 I126V A G missense Het probably benign 0.329 0.062 09/17/2014
20 227933 UTSW Crocc 0.294 R2130 G1 225 Y 4 141029102 I1071V T C missense Het probably benign 0.036 0.014 phenotype 09/17/2014
21 227925 UTSW Dbt 1.000 R2130 G1 225 Y 3 116539124 D16E T A missense Het probably damaging 0.999 0.190 phenotype 09/17/2014
22 227931 UTSW Dnajc8 0.882 R2130 G1 225 Y 4 132544059 S62P T C missense Het possibly damaging 0.947 0.280 09/17/2014
23 227926 UTSW Dpyd 0.276 R2130 G1 225 Y 3 118674568 V77A T C missense Het probably benign 0.000 0.094 phenotype 09/17/2014
24 227923 UTSW Dram2 0.102 R2130 G1 225 Y 3 106570760 M136K T A missense Het possibly damaging 0.720 0.248 09/17/2014
25 227938 UTSW Dtx2 0.000 R2130 G1 225 Y 5 136012040 F100I T A missense Het probably damaging 0.964 0.194 phenotype 09/17/2014
26 227960 UTSW Dync2h1 1.000 R2130 G1 225 Y 9 7011253 W3654R A T missense Het probably damaging 1.000 0.648 phenotype 09/17/2014
27 227914 UTSW Fam129b 0.552 R2130 G1 225 Y 2 32923647 K624R A G missense Het probably benign 0.345 0.066 09/17/2014
28 227989 UTSW Fam208a 1.000 R2130 G1 225 Y 14 27446388 Y296N T A missense Het probably damaging 1.000 0.234 phenotype 09/17/2014
29 227990 UTSW Fam208a 1.000 R2130 G1 225 Y 14 27476614 N1301S A G missense Het possibly damaging 0.735 0.144 phenotype 09/17/2014
30 227970 UTSW Fbxw10 0.067 R2130 G1 225 Y 11 62859857 I422N T A missense Het probably damaging 0.988 0.035 phenotype 09/17/2014
31 227993 UTSW Fgf17 0.199 R2130 G1 225 Y 14 70638487 R102G T C missense Het probably damaging 0.975 0.162 phenotype 09/17/2014
32 227937 UTSW Gatsl2 0.298 R2130 G1 225 Y 5 134136153 C187Y G A missense Het probably damaging 0.998 0.072 09/17/2014
33 227898 UTSW Gm28040 0.172 R2130 G1 129 Y 1 133327321 AGTG AGTGGCACCTTTGGTG small insertion Het probably benign 09/17/2014
34 227942 UTSW Gm6578 0.792 R2130 G1 225 Y 6 12100187 C A exon Het noncoding transcript 0.066 09/17/2014
35 227919 UTSW Gm8298 0.110 R2130 G1 225 Y 3 59865348 V91A T C missense Het probably damaging 1.000 0.260 09/17/2014
36 227988 UTSW Gm8374 0.097 R2130 G1 134 Y 14 7364194 T49A T C missense Het probably damaging 0.998 0.044 09/17/2014
37 227963 UTSW Gm9797 0.384 R2130 G1 225 Y 10 11609369 G T exon Het noncoding transcript 0.051 09/17/2014
38 227935 UTSW Golga3 0.000 R2130 G1 225 Y 5 110202939 T C critical splice donor site 2 bp Het probably null 0.468 phenotype 09/17/2014
39 227920 UTSW Golim4 0.379 R2130 G1 225 Y 3 75908149 V116D A T missense Het probably damaging 1.000 0.308 phenotype 09/17/2014
40 227908 UTSW Igfn1 0.221 R2130 G1 217 Y 1 135974852 AGGG AGG splice site Het probably benign 09/17/2014
41 227921 UTSW Insrr 0.129 R2130 G1 225 Y 3 87810572 G A splice site 5 bp Het probably null 0.639 phenotype 09/17/2014
42 227905 UTSW Ipo9 1.000 R2130 G1 217 Y 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 09/17/2014
43 227906 UTSW Ipo9 1.000 R2130 G1 225 Y 1 135402250 V484A A G missense Het probably benign 0.000 0.116 phenotype 09/17/2014
44 227950 UTSW Isoc2b 0.238 R2130 G1 225 Y 7 4851439 I31N A T missense Het probably damaging 0.965 0.326 09/17/2014
45 227916 UTSW Kif5c 0.000 R2130 G1 225 Y 2 49758805 T A splice site Het probably benign 0.058 phenotype 09/17/2014
46 227977 UTSW Krtap16-1 0.054 R2130 G1 225 Y 11 99985776 C267* A T nonsense Het probably null 0.653 09/17/2014
47 227912 UTSW Lamc2 0.519 R2130 G1 225 Y 1 153127124 D1037V T A missense Het probably damaging 1.000 0.148 phenotype 09/17/2014
48 227987 UTSW Lhfpl2 0.133 R2130 G1 225 Y 13 94192049 D206G A G missense Het possibly damaging 0.906 0.272 phenotype 09/17/2014
49 227939 UTSW Lmtk2 0.251 R2130 G1 225 Y 5 144174988 T842I C T missense Het possibly damaging 0.605 0.014 phenotype 09/17/2014
50 227981 UTSW Mgat2 0.674 R2130 G1 225 Y 12 69185294 F214S T C missense Het probably damaging 1.000 0.176 phenotype 09/17/2014
51 227955 UTSW Mki67 0.694 R2130 G1 225 Y 7 135704241 T A critical splice acceptor site Het probably null 0.480 phenotype 09/17/2014
52 227974 UTSW Mpo 0.000 R2130 G1 225 Y 11 87797361 D282G A G missense Het possibly damaging 0.897 0.112 phenotype 09/17/2014
53 227971 UTSW Myh10 1.000 R2130 G1 225 Y 11 68807289 A G splice site Het probably benign 0.045 phenotype 09/17/2014
54 227979 UTSW Myo15b 0.052 R2130 G1 225 Y 11 115871643 V1229I G A missense Het probably benign 0.081 0.121 09/17/2014
55 227953 UTSW Nfatc2ip 0.362 R2130 G1 225 Y 7 126390462 V250A A G missense Het probably benign 0.001 0.068 phenotype 09/17/2014
56 227959 UTSW Nrp1 1.000 R2130 G1 225 Y 8 128498516 E782D A T missense Het probably damaging 1.000 0.080 phenotype 09/17/2014
57 227922 UTSW Olfml3 0.000 R2130 G1 225 Y 3 103735869 M399L T A missense Het probably benign 0.055 0.102 phenotype 09/17/2014
58 227915 UTSW Olfr341 0.073 R2130 G1 225 Y 2 36480047 S28P A G missense Het possibly damaging 0.869 0.055 phenotype 09/17/2014
59 227943 UTSW Olfr453 0.323 R2130 G1 225 Y 6 42744135 L33M C A missense Het possibly damaging 0.613 0.068 phenotype 09/17/2014
60 227951 UTSW Olfr683 0.060 R2130 G1 225 Y 7 105143550 I254F T A missense Het probably benign 0.032 0.414 phenotype 09/17/2014
61 227900 UTSW Optc 0.000 R2130 G1 225 Y 1 133903796 A T splice site Het probably null 0.626 phenotype 09/17/2014
62 227897 UTSW Plekha6 0.150 R2130 G1 225 Y 1 133279365 C A intron Het probably null 0.636 09/17/2014
63 227901 UTSW Prelp 0.095 R2130 G1 225 Y 1 133915131 R92K C T missense Het probably benign 0.000 0.116 phenotype 09/17/2014
64 227936 UTSW Psph 0.222 R2130 G1 116 Y 5 129787539 T A unclassified Het probably null 0.657 phenotype 09/17/2014
65 227949 UTSW Ptpro 0.000 R2130 G1 225 Y 6 137411116 A G splice site 3 bp Het probably null 0.652 phenotype 09/17/2014
66 227947 UTSW Pzp 0.107 R2130 G1 225 Y 6 128491161 T C splice site 4 bp Het probably null 0.634 phenotype 09/17/2014
67 227980 UTSW Qrich2 0.146 R2130 G1 225 Y 11 116448417 C T splice site Het probably benign 0.052 09/17/2014
68 277480 UTSW Ren1 1.000 R2130 G1 70 Y 1 133350778 C G unclassified Het probably null 0.117 phenotype 04/10/2015
69 227958 UTSW Rfwd3 0.486 R2130 G1 225 N 8 111297402 V96E A T missense Het probably benign 0.048 phenotype 09/17/2014
70 227992 UTSW Rnf17 0.544 R2130 G1 225 Y 14 56493354 V1205A T C missense Het probably damaging 0.999 0.196 phenotype 09/17/2014
71 227995 UTSW Senp1 1.000 R2130 G1 225 Y 15 98075967 T132S T A missense Het probably benign 0.002 0.119 phenotype 09/17/2014
72 227956 UTSW Sgo2b 0.159 R2130 G1 225 Y 8 63927147 R884G T C missense Het probably benign 0.094 0.101 09/17/2014
73 227918 UTSW Slc10a5 0.052 R2130 G1 225 Y 3 10335218 D127E G T missense Het probably benign 0.000 0.068 09/17/2014
74 227972 UTSW Slc25a35 0.000 R2130 G1 225 Y 11 68968965 S101R T G missense Het possibly damaging 0.878 0.144 phenotype 09/17/2014
75 227945 UTSW Slc6a13 0.440 R2130 G1 225 Y 6 121325041 L194P T C missense Het possibly damaging 0.775 0.062 phenotype 09/17/2014
76 227983 UTSW Snw1 0.946 R2130 G1 225 Y 12 87452703 T G unclassified Het probably benign 0.084 phenotype 09/17/2014
77 227924 UTSW Sort1 0.581 R2130 G1 225 Y 3 108351686 F678Y T A missense Het probably benign 0.000 0.050 phenotype 09/17/2014
78 227929 UTSW Srsf12 0.139 R2130 G1 225 N 4 33225764 C T critical splice acceptor site Het probably benign 09/17/2014
79 228001 UTSW Ssxa1 0.051 R2130 G1 222 Y X 21119342 T A splice site Het probably benign 0.164 09/17/2014
80 227941 UTSW Stard13 0.000 R2130 G1 225 Y 5 151045168 Y879C T C missense Het probably damaging 1.000 0.468 phenotype 09/17/2014
81 227902 UTSW Syt2 0.303 R2130 G1 217 Y 1 134746741 ACTCTCTCT ACTCTCTCTCT splice site Het probably benign phenotype 09/17/2014
82 227927 UTSW Tacr3 0.000 R2130 G1 225 Y 3 134932180 V366A T C missense Het probably benign 0.001 0.066 phenotype 09/17/2014
83 227940 UTSW Tecpr1 0.000 R2130 G1 225 Y 5 144208645 T595S T A missense Het probably benign 0.012 0.036 phenotype 09/17/2014
84 227964 UTSW Tjp3 0.000 R2130 G1 225 Y 10 81278054 M457L T A missense Het possibly damaging 0.524 0.098 phenotype 09/17/2014
85 227998 UTSW Tkfc 0.085 R2130 G1 225 Y 19 10596041 I279T A G missense Het probably damaging 0.972 0.256 phenotype 09/17/2014
86 227973 UTSW Tmem98 0.142 R2130 G1 225 Y 11 80817522 E106G A G missense Het probably damaging 0.999 0.202 phenotype 09/17/2014
87 227907 UTSW Tnnt2 1.000 R2130 G1 217 Y 1 135846761 TG TGG splice site Het probably benign phenotype 09/17/2014
88 227968 UTSW Trim41 0.298 R2130 G1 225 Y 11 48807592 G516W C A missense Het probably damaging 0.999 0.334 phenotype 09/17/2014
89 227911 UTSW Trove2 0.155 R2130 G1 225 Y 1 143760034 D458G T C missense Het probably benign 0.000 0.132 phenotype 09/17/2014
90 227917 UTSW Ttn 1.000 R2130 G1 225 Y 2 76742517 T24265A T C missense Het possibly damaging 0.955 0.112 phenotype 09/17/2014
91 227896 UTSW Usp37 0.964 R2130 G1 225 Y 1 74461656 V582A A G missense Het probably damaging 0.999 0.256 phenotype 09/17/2014
92 227994 UTSW Vps13b 0.478 R2130 G1 225 Y 15 35671400 I1683N T A missense Het probably benign 0.128 0.099 phenotype 09/17/2014
93 227934 UTSW Vps13d 1.000 R2130 G1 211 Y 4 145156101 R968H C T missense Het probably benign 0.166 0.128 phenotype 09/17/2014
94 227946 UTSW Vwf 0.307 R2130 G1 187 Y 6 125657057 T166I C T missense Het probably damaging 1.000 0.078 phenotype 09/17/2014
95 227961 UTSW Zfp280d 0.191 R2130 G1 225 Y 9 72308005 F133L T C missense Het probably damaging 0.999 0.148 09/17/2014
96 227985 UTSW Zfp459 0.088 R2130 G1 225 Y 13 67408276 H229Q A T missense Het probably benign 0.044 0.278 09/17/2014
97 227982 UTSW Zfyve26 0.677 R2130 G1 225 N 12 79268434 I1423F T A missense Het possibly damaging 0.481 phenotype 09/17/2014
98 227913 UTSW Zmynd19 0.085 R2130 G1 225 Y 2 24952636 Y15* T A nonsense Het probably null 0.612 phenotype 09/17/2014
[records 1 to 98 of 98]