Incidental Mutations

104 incidental mutations are currently displayed, and affect 103 genes.
15 are Possibly Damaging.
34 are Probably Damaging.
37 are Probably Benign.
15 are Probably Null.
3 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 104] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 236279 UTSW 1810065E05Rik 0.086 R2141 G1 225 Y 11 58423926 C150F G T missense Het probably damaging 1.000 0.022 10/01/2014
2 236249 UTSW 4932431P20Rik 0.000 R2141 G1 225 Y 7 29531510 T C exon Het noncoding transcript 0.068 10/01/2014
3 236262 UTSW Aagab 0.097 R2141 G1 225 Y 9 63616675 T A splice site Het probably null 0.618 phenotype 10/01/2014
4 236253 UTSW Abca15 0.068 R2141 G1 225 Y 7 120407474 T1654P A C missense Het probably damaging 1.000 0.026 10/01/2014
5 236297 UTSW Abca17 0.000 R2141 G1 225 Y 17 24334266 Y157F T A missense Het probably benign 0.004 0.122 10/01/2014
6 236278 UTSW Aftph 0.750 R2141 G1 225 Y 11 20698318 L813* A T nonsense Het probably null 0.542 10/01/2014
7 236197 UTSW Agap1 0.188 R2141 G1 225 Y 1 89837755 I615T T C missense Het probably damaging 0.991 0.280 phenotype 10/01/2014
8 236302 UTSW Ak3 0.372 R2141 G1 225 Y 19 29022847 Q221H T G missense Het probably benign 0.005 0.106 phenotype 10/01/2014
9 236255 UTSW Aldoa 1.000 R2141 G1 225 Y 7 126797642 A G critical splice donor site 2 bp Het probably null 0.510 phenotype 10/01/2014
10 236290 UTSW Anxa8 0.000 R2141 G1 225 Y 14 34091916 T C critical splice donor site 2 bp Het probably null 0.520 phenotype 10/01/2014
11 236275 UTSW Baz2a 0.000 R2141 G1 225 Y 10 128123612 D1329G A G missense Het probably damaging 0.996 0.152 10/01/2014
12 236260 UTSW Capn9 0.070 R2141 G1 225 Y 8 124605711 G430R G A missense Het possibly damaging 0.900 0.063 phenotype 10/01/2014
13 236200 UTSW Cd55 0.000 R2141 G1 225 Y 1 130449423 V333I C T missense Het probably benign 0.316 0.128 phenotype 10/01/2014
14 236265 UTSW Cep70 0.203 R2141 G1 225 Y 9 99296385 Y512C A G missense Het probably damaging 1.000 0.440 10/01/2014
15 236213 UTSW Cfhr2 0.065 R2141 G1 132 Y 1 139831155 R52S T G missense Het probably benign 0.413 0.122 10/01/2014
16 236235 UTSW Clcn6 0.137 R2141 G1 225 Y 4 148024137 F145S A G missense Het possibly damaging 0.883 0.322 phenotype 10/01/2014
17 236233 UTSW Cnksr1 0.276 R2141 G1 225 Y 4 134229628 Y488H A G missense Het probably damaging 1.000 0.094 phenotype 10/01/2014
18 236239 UTSW Diablo 0.000 R2141 G1 225 Y 5 123523361 V24A A G missense Het probably benign 0.011 phenotype 10/01/2014
19 236195 UTSW Dnah7b 0.166 R2141 G1 225 Y 1 46268670 M3048K T A missense Het probably damaging 1.000 0.170 10/01/2014
20 236198 UTSW Dsel 0.121 R2141 G1 225 Y 1 111859457 N1116S T C missense Het probably benign 0.000 0.136 phenotype 10/01/2014
21 236304 UTSW Efnb1 1.000 R2141 G1 222 Y X 99147517 Y343C A G missense Het probably damaging 1.000 0.452 phenotype 10/01/2014
22 236299 UTSW Esco1 0.388 R2141 G1 225 Y 18 10574873 A G critical splice donor site 2 bp Het probably null 0.608 phenotype 10/01/2014
23 236292 UTSW Fam173b 0.172 R2141 G1 218 Y 15 31609572 F146L T C missense Het probably benign 0.091 0.128 10/01/2014
24 314424 UTSW Fam26f 0.000 R2141 G1 66 Y 10 34127695 A72E G T missense Het probably damaging 0.967 0.358 05/06/2015
25 236244 UTSW Fancd2 1.000 R2141 G1 225 Y 6 113549321 N335S A G missense Het probably benign 0.004 0.124 phenotype 10/01/2014
26 236243 UTSW Flnc 1.000 R2141 G1 225 Y 6 29448675 Y1304C A G missense Het probably damaging 0.999 0.134 phenotype 10/01/2014
27 236219 UTSW Fubp3 0.630 R2141 G1 225 Y 2 31600557 A G unclassified Het probably benign 10/01/2014
28 236283 UTSW Gemin4 0.955 R2141 G1 225 Y 11 76211050 P962A G C missense Het probably damaging 1.000 0.208 phenotype 10/01/2014
29 236240 UTSW Gjc3 0.000 R2141 G1 225 Y 5 137957546 L159R A C missense Het probably damaging 1.000 0.200 phenotype 10/01/2014
30 236273 UTSW Gli1 0.000 R2141 G1 225 Y 10 127336727 L182P A G missense Het probably damaging 0.998 0.164 phenotype 10/01/2014
31 236254 UTSW Gm21957 0.193 R2141 G1 225 Y 7 125219453 G T exon Het noncoding transcript 0.058 10/01/2014
32 236202 UTSW Gm28040 0.151 R2141 G1 145 Y 1 133327321 AGTG AGTGGCACCTTTGGTG small insertion Het probably benign 10/01/2014
33 236303 UTSW Gm4907 0.054 R2141 G1 222 Y X 23907310 V350E T A missense Het probably benign 0.314 0.118 10/01/2014
34 236247 UTSW Gm5885 0.066 R2141 G1 220 Y 6 133529275 A G exon Het noncoding transcript 0.051 10/01/2014
35 236252 UTSW Gm8989 0.280 R2141 G1 225 Y 7 106329956 T245S T A missense Het probably damaging 0.968 0.032 10/01/2014
36 236230 UTSW Gon4l 0.803 R2141 G1 225 Y 3 88887595 T402S A T missense Het possibly damaging 0.659 0.042 phenotype 10/01/2014
37 236305 UTSW Gprasp1 0.119 R2141 G1 222 Y X 135802042 E995K G A missense Het possibly damaging 0.566 0.167 phenotype 10/01/2014
38 236272 UTSW Helb 0.129 R2141 G1 225 Y 10 120106021 M254K A T missense Het possibly damaging 0.736 0.055 phenotype 10/01/2014
39 236284 UTSW Ift20 1.000 R2141 G1 225 Y 11 78540034 E68K G A missense Het probably damaging 0.995 0.188 phenotype 10/01/2014
40 236210 UTSW Igfn1 0.078 R2141 G1 217 Y 1 135974852 AGGG AGG splice site Het probably benign 10/01/2014
41 236267 UTSW Impdh2 1.000 R2141 G1 225 Y 9 108565347 E305G A G missense Het possibly damaging 0.499 0.320 phenotype 10/01/2014
42 236217 UTSW Ints7 0.947 R2141 G1 225 Y 1 191604860 C351S T A missense Het possibly damaging 0.728 0.080 phenotype 10/01/2014
43 236207 UTSW Ipo9 1.000 R2141 G1 217 Y 1 135386268 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC small insertion Het probably benign phenotype 10/01/2014
44 236208 UTSW Ipo9 1.000 R2141 G1 225 Y 1 135402250 V484A A G missense Het probably benign 0.000 0.116 phenotype 10/01/2014
45 236293 UTSW Kcnq3 0.171 R2141 G1 225 Y 15 65995851 M648V T C missense Het probably benign 0.214 0.100 phenotype 10/01/2014
46 236300 UTSW Kctd16 0.187 R2141 G1 225 Y 18 40259178 E273G A G missense Het possibly damaging 0.892 0.190 phenotype 10/01/2014
47 236226 UTSW Kif18a 0.000 R2141 G1 225 Y 2 109333503 N732K T A missense Het probably benign 0.425 0.125 phenotype 10/01/2014
48 236211 UTSW Kif21b 0.177 R2141 G1 225 Y 1 136152264 R513W C T missense Het probably damaging 0.981 0.030 phenotype 10/01/2014
49 236259 UTSW Klhl36 0.196 R2141 G1 225 Y 8 119876772 C589R T C missense Het possibly damaging 0.941 0.352 10/01/2014
50 236232 UTSW Lck 0.000 R2141 G1 225 Y 4 129548920 Y481H A G missense Het probably damaging 1.000 0.220 phenotype 10/01/2014
51 236241 UTSW Lmtk2 0.273 R2141 G1 225 Y 5 144147615 Y156C A G missense Het probably damaging 1.000 0.126 phenotype 10/01/2014
52 236245 UTSW Mical3 0.177 R2141 G1 225 Y 6 121031134 A T splice site Het probably null 0.646 10/01/2014
53 236257 UTSW Mki67 0.842 R2141 G1 225 Y 7 135695592 I2571T A G missense Het possibly damaging 0.940 0.108 phenotype 10/01/2014
54 236295 UTSW Mx2 0.220 R2141 G1 225 Y 16 97538703 E20K G A missense Het probably benign 0.088 0.058 phenotype 10/01/2014
55 236291 UTSW Myo10 0.000 R2141 G1 199 Y 15 25714108 E87G A G missense Het probably benign 0.000 0.111 phenotype 10/01/2014
56 236237 UTSW Myo18b 1.000 R2141 G1 225 Y 5 112874026 K500R T C missense Het probably benign 0.012 0.112 phenotype 10/01/2014
57 236242 UTSW N4bp2l2 0.288 R2141 G1 225 Y 5 150647536 I458N A T missense Het probably damaging 0.998 0.290 10/01/2014
58 236225 UTSW Nat10 1.000 R2141 G1 214 Y 2 103731303 T C splice site 4 bp Het probably null 0.624 phenotype 10/01/2014
59 236201 UTSW Nfasc 1.000 R2141 G1 225 Y 1 132596645 P932L G A missense Het probably damaging 1.000 0.450 phenotype 10/01/2014
60 236251 UTSW Nipa1 0.000 R2141 G1 225 Y 7 55997511 C A splice site 5 bp Het probably null 0.648 phenotype 10/01/2014
61 236248 UTSW Nkpd1 0.066 R2141 G1 183 Y 7 19524237 Q647R A G missense Het probably damaging 0.990 0.022 10/01/2014
62 236298 UTSW Nlrc4 0.143 R2141 G1 225 Y 17 74447951 T A splice site Het probably benign phenotype 10/01/2014
63 236269 UTSW Nmbr 0.068 R2141 G1 225 Y 10 14770442 Y353* C A nonsense Het probably null 0.624 phenotype 10/01/2014
64 236215 UTSW Nos1ap 0.000 R2141 G1 193 Y 1 170329166 D241V T A missense Het probably damaging 0.974 0.078 10/01/2014
65 236196 UTSW Obsl1 0.215 R2141 G1 225 Y 1 75486756 T1764M G A missense Het probably benign 0.000 0.033 10/01/2014
66 236221 UTSW Olfr1025-ps1 0.063 R2141 G1 225 Y 2 85918827 I301V A G missense Het probably null 0.000 0.608 10/01/2014
67 236223 UTSW Olfr1173 0.073 R2141 G1 225 Y 2 88275010 V13A A G missense Het probably benign 0.304 0.176 phenotype 10/01/2014
68 236227 UTSW Olfr1289 0.134 R2141 G1 225 Y 2 111483630 T95S A T missense Het probably benign 0.232 0.060 phenotype 10/01/2014
69 236276 UTSW Olfr770 0.066 R2141 G1 225 Y 10 129133006 I254T A G missense Het probably benign 0.230 0.192 phenotype 10/01/2014
70 236203 UTSW Optc 0.000 R2141 G1 225 Y 1 133903796 A T splice site Het probably null 0.626 phenotype 10/01/2014
71 314425 UTSW Pank1 0.160 R2141 G1 40 Y 19 34878980 R33C G A missense Het possibly damaging 0.914 0.258 phenotype 05/06/2015
72 236194 UTSW Pcmtd1 0.098 R2141 G1 225 Y 1 7169565 R77C C T missense Het probably damaging 1.000 0.322 10/01/2014
73 236256 UTSW Phkg2 0.464 R2141 G1 225 Y 7 127582214 G A critical splice donor site 1 bp Het probably null 0.642 phenotype 10/01/2014
74 236228 UTSW Plcb4 0.000 R2141 G1 225 Y 2 135976099 V762M G A missense Het probably damaging 1.000 0.306 phenotype 10/01/2014
75 236222 UTSW Pramel7 0.080 R2141 G1 225 Y 2 87489977 H324L T A missense Het probably damaging 0.998 0.036 10/01/2014
76 236204 UTSW Prelp 0.000 R2141 G1 225 Y 1 133915131 R92K C T missense Het probably benign 0.000 0.116 phenotype 10/01/2014
77 236280 UTSW Rai1 1.000 R2141 G1 225 Y 11 60189467 S1452R C A missense Het possibly damaging 0.937 0.065 phenotype 10/01/2014
78 314423 UTSW Ren1 1.000 R2141 G1 37 Y 1 133350778 C G unclassified Het probably null 0.117 phenotype 05/06/2015
79 236270 UTSW Rev3l 1.000 R2141 G1 225 Y 10 39848049 V785A T C missense Het probably benign 0.017 0.150 phenotype 10/01/2014
80 236271 UTSW Rufy2 0.000 R2141 G1 225 Y 10 62990994 R104L G T missense Het probably damaging 1.000 0.410 10/01/2014
81 236263 UTSW Senp6 1.000 R2141 G1 225 Y 9 80123820 N8K T A missense Het probably damaging 1.000 0.238 phenotype 10/01/2014
82 236286 UTSW Sept4 0.717 R2141 G1 225 Y 11 87583436 Q60L A T missense Het probably benign 0.262 0.066 phenotype 10/01/2014
83 236261 UTSW Sipa1l2 0.331 R2141 G1 225 Y 8 125491491 P369L G A missense Het probably benign 0.068 0.140 phenotype 10/01/2014
84 236220 UTSW Slc43a1 0.082 R2141 G1 225 Y 2 84840961 L37P T C missense Het probably damaging 1.000 0.034 phenotype 10/01/2014
85 236289 UTSW Slf1 0.000 R2141 G1 225 Y 13 77049219 T A critical splice acceptor site Het probably null 0.462 phenotype 10/01/2014
86 236229 UTSW Ssr2 1.000 R2141 G1 225 Y 3 88576642 T A unclassified Het probably benign phenotype 10/01/2014
87 236205 UTSW Syt2 0.149 R2141 G1 217 Y 1 134746741 ACTCTCTCT ACTCTCTCTCT splice site Het probably benign phenotype 10/01/2014
88 236246 UTSW Tas2r115 0.052 R2141 G1 225 Y 6 132737358 K210R T C missense Het probably benign 0.430 0.134 10/01/2014
89 236264 UTSW Tbx18 1.000 R2141 G1 225 Y 9 87715653 V276A A G missense Het probably damaging 0.994 0.150 phenotype 10/01/2014
90 236231 UTSW Tie1 1.000 R2141 G1 225 Y 4 118472811 R1072* G A nonsense Het probably null 0.588 phenotype 10/01/2014
91 236258 UTSW Tm2d2 1.000 R2141 G1 225 Y 8 25022658 T174K C A missense Het probably damaging 0.959 0.023 phenotype 10/01/2014
92 236285 UTSW Tmem98 1.000 R2141 G1 225 Y 11 80814332 D82G A G missense Het possibly damaging 0.927 0.060 phenotype 10/01/2014
93 236287 UTSW Tmub2 0.000 R2141 G1 225 Y 11 102287553 E94G A G missense Het possibly damaging 0.892 0.212 phenotype 10/01/2014
94 236209 UTSW Tnnt2 1.000 R2141 G1 217 Y 1 135846761 TG TGG splice site Het probably benign phenotype 10/01/2014
95 236294 UTSW Tonsl 1.000 R2141 G1 225 Y 15 76632661 I923N A T missense Het probably damaging 0.991 0.220 phenotype 10/01/2014
96 236214 UTSW Trove2 0.244 R2141 G1 225 Y 1 143760034 D458G T C missense Het probably benign 0.000 0.132 phenotype 10/01/2014
97 236268 UTSW Ttc21a 0.425 R2141 G1 225 Y 9 119964295 V977M G A missense Het probably damaging 0.978 0.025 10/01/2014
98 236288 UTSW Ube2ql1 0.120 R2141 G1 225 Y 13 69738664 D226G T C missense Het probably damaging 0.999 0.078 10/01/2014
99 236234 UTSW Ubr4 1.000 R2141 G1 225 Y 4 139477207 T4810M C T missense Het probably damaging 0.974 0.388 phenotype 10/01/2014
100 236301 UTSW Zadh2 0.221 R2141 G1 225 Y 18 84094543 Y115H T C missense Het probably benign 0.004 0.080 10/01/2014
[records 1 to 100 of 104] next >> last >|