Incidental Mutations

42 incidental mutations are currently displayed, and affect 42 genes.
4 are Possibly Damaging.
17 are Probably Damaging.
17 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 42 of 42] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 476798 UTSW A330087D11Rik R2857 G1 225 N 7 29573878 A T critical splice donor site Het noncoding transcript 05/15/2017
2 252488 UTSW Amfr 0.476 R2857 G1 225 N 8 94005214 N11K A T missense Het probably damaging 1.000 0.282 phenotype 12/04/2014
3 252453 UTSW Bpifa6 0.078 R2857 G1 225 N 2 153989274 M253I G A missense Het probably benign 0.032 12/04/2014
4 252527 UTSW C330018D20Rik 0.167 R2857 G1 225 N 18 56962459 L18P A G missense Het probably benign 0.014 12/04/2014
5 252490 UTSW Cd109 0.000 R2857 G1 154 N 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.156 phenotype 12/04/2014
6 252495 UTSW Cdh23 0.000 R2857 G1 225 N 10 60382653 C T critical splice donor site 1 bp Het probably null 0.716 phenotype 12/04/2014
7 252474 UTSW Ceacam1 0.149 R2857 G1 225 N 7 25474017 I249F T A missense Het probably damaging 0.962 0.131 phenotype 12/04/2014
8 252502 UTSW Cfap54 0.173 R2857 G1 225 N 10 93045282 R348Q C T missense Het probably damaging 0.987 phenotype 12/04/2014
9 252521 UTSW Crygs 0.000 R2857 G1 225 N 16 22805551 G102D C T missense Het possibly damaging 0.927 0.097 phenotype 12/04/2014
10 252482 UTSW Cuzd1 0.139 R2857 G1 225 N 7 131316134 V246M C T missense Het probably damaging 0.973 0.224 phenotype 12/04/2014
11 252472 UTSW Ehd2 0.214 R2857 G1 225 N 7 15964129 V61E A T missense Het probably damaging 0.998 0.690 phenotype 12/04/2014
12 252519 UTSW Erich5 0.108 R2857 G1 225 N 15 34471414 T263I C T missense Het probably damaging 0.996 12/04/2014
13 252507 UTSW Fam71b 0.084 R2857 G1 225 N 11 46405212 I137T T C missense Het probably damaging 0.999 12/04/2014
14 252445 UTSW Fbxo36 0.251 R2857 G1 225 N 1 84896595 K104R A G missense Het probably benign 0.002 0.120 phenotype 12/04/2014
15 252451 UTSW Fibin 0.142 R2857 G1 225 N 2 110362197 R200H C T missense Het probably damaging 0.990 0.035 12/04/2014
16 252447 UTSW Gad2 0.000 R2857 G1 225 N 2 22673975 M397L A C missense Het probably benign 0.017 phenotype 12/04/2014
17 252468 UTSW Gm5724 0.123 R2857 G1 225 N 6 141744538 V163A A G missense Het probably benign 0.350 12/04/2014
18 252455 UTSW Iqgap3 0.419 R2857 G1 225 N 3 88107596 S873* C A nonsense Het probably null 0.654 12/04/2014
19 252525 UTSW Kcnh8 0.302 R2857 G1 225 N 17 52977933 D977G A G missense Het probably benign 0.000 phenotype 12/04/2014
20 252524 UTSW Maats1 0.617 R2857 G1 225 N 16 38302713 L651R A C missense Het probably damaging 1.000 12/04/2014
21 252485 UTSW Mau2 0.918 R2857 G1 225 N 8 70019824 M570V T C missense Het probably benign 0.084 phenotype 12/04/2014
22 252476 UTSW Mrgprb4 0.000 R2857 G1 225 N 7 48198336 R281S T A missense Het possibly damaging 0.909 0.064 phenotype 12/04/2014
23 252514 UTSW Mthfd1 1.000 R2857 G1 225 N 12 76288925 Y258H T C missense Het probably damaging 0.991 0.284 phenotype 12/04/2014
24 252457 UTSW Nexn 0.508 R2857 G1 225 N 3 152248043 E247K C T missense Het probably damaging 1.000 0.416 phenotype 12/04/2014
25 252511 UTSW Olfr139 0.082 R2857 G1 225 N 11 74044827 G149D C T missense Het possibly damaging 0.930 0.087 phenotype 12/04/2014
26 252509 UTSW Olfr311 0.058 R2857 G1 225 N 11 58841882 V256E T A missense Het probably benign 0.418 0.062 phenotype 12/04/2014
27 252517 UTSW Olfr743 0.075 R2857 G1 210 N 14 50533440 N9K T A missense Het probably benign 0.185 0.121 phenotype 12/04/2014
28 252484 UTSW Phrf1 0.142 R2857 G1 225 N 7 141259680 T A unclassified Het probably benign 12/04/2014
29 252477 UTSW Prc1 1.000 R2857 G1 225 N 7 80312221 N52S A G missense Het probably damaging 0.993 phenotype 12/04/2014
30 252531 UTSW Psd 0.507 R2857 G1 225 N 19 46324420 S170R G C missense Het probably benign 0.001 phenotype 12/04/2014
31 252515 UTSW Riok1 0.929 R2857 G1 225 N 13 38049077 F229L T C missense Het probably damaging 1.000 phenotype 12/04/2014
32 252504 UTSW Stat2 0.337 R2857 G1 225 N 10 128276901 A G splice site 3 bp Het probably null phenotype 12/04/2014
33 252499 UTSW Sycp3 0.416 R2857 G1 225 N 10 88467372 E166G A G missense Het probably damaging 0.999 0.360 phenotype 12/04/2014
34 252458 UTSW Szt2 0.698 R2857 G1 225 N 4 118369402 T510I G A missense Het probably damaging 1.000 phenotype 12/04/2014
35 252491 UTSW Trank1 0.000 R2857 G1 225 N 9 111366933 T1342S A T missense Het probably benign 0.002 12/04/2014
36 476800 UTSW Trav3-1 0.046 R2857 G1 225 N 14 52581058 A63E C A missense Het probably benign 0.072 05/15/2017
37 252480 UTSW Trim34b 0.657 R2857 G1 225 N 7 104336232 N358I A T missense Het probably benign 0.004 0.117 12/04/2014
38 252493 UTSW Trmt11 0.298 R2857 G1 154 N 10 30547748 P387R G C missense Het probably damaging 0.976 0.338 12/04/2014
39 252498 UTSW Vmn2r82 0.211 R2857 G1 225 N 10 79381256 I474N T A missense Het probably damaging 0.978 0.033 12/04/2014
40 252506 UTSW Vrk2 0.593 R2857 G1 225 N 11 26483324 S286I C A missense Het possibly damaging 0.543 0.095 phenotype 12/04/2014
41 252460 UTSW Wdfy3 0.877 R2857 G1 225 N 5 101875930 I2451N A T missense Het probably benign 0.041 phenotype 12/04/2014
42 252462 UTSW Zfp326 0.258 R2857 G1 225 N 5 105888529 R102H G A missense Het probably benign 0.111 12/04/2014
[records 1 to 42 of 42]