Incidental Mutations

21 incidental mutations are currently displayed, and affect 21 genes.
4 are Possibly Damaging.
3 are Probably Damaging.
14 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 21 of 21] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 254970 UTSW Alms1 0.000 R2932 G1 225 N 6 85620562 D1259G A G missense Het possibly damaging 0.893 phenotype 12/29/2014
2 254978 UTSW Arpp21 0.000 R2932 G1 225 N 9 112179105 D106G T C missense Het probably damaging 0.999 phenotype 12/29/2014
3 254984 UTSW Atp6v1a 0.983 R2932 G1 225 N 16 44089043 S542P A G missense Het probably benign 0.032 phenotype 12/29/2014
4 254979 UTSW Ccar1 0.891 R2932 G1 81 N 10 62776759 N209S T C missense Het probably benign 0.084 12/29/2014
5 254976 UTSW Ccdc15 0.224 R2932 G1 225 N 9 37315658 T327I G A missense Het probably benign 0.004 12/29/2014
6 254967 UTSW Dhx15 0.914 R2932 G1 225 N 5 52166732 P406L G A missense Het probably benign 0.014 0.252 phenotype 12/29/2014
7 254975 UTSW Fat3 0.436 R2932 G1 225 N 9 16375944 S761L G A missense Het probably damaging 0.999 phenotype 12/29/2014
8 254966 UTSW Lor 0.233 R2932 G1 117 N 3 92081878 AGCCGCCGCCGCCGCCGCCGCCGCCGCC AGCCGCCGCCGCCGCCGCCGCCGCC small deletion Het probably benign phenotype 12/29/2014
9 254977 UTSW Lrrc1 0.244 R2932 G1 225 N 9 77457439 H153L T A missense Het probably benign 0.013 12/29/2014
10 254981 UTSW Lrrc46 0.097 R2932 G1 225 N 11 97041109 T C unclassified Het probably benign 12/29/2014
11 254971 UTSW Mrgprb2 0.119 R2932 G1 225 N 7 48552446 L177S A G missense Het probably benign 0.168 phenotype 12/29/2014
12 254973 UTSW Mtmr2 0.255 R2932 G1 107 N 9 13749117 A T unclassified Het probably benign phenotype 12/29/2014
13 254974 UTSW Mtnr1b 0.000 R2932 G1 225 N 9 15874324 V46E A T missense Het probably damaging 0.966 phenotype 12/29/2014
14 477478 UTSW Myo5a 0.877 R2932 G1 225 N 9 75196136 E207G A G missense Het possibly damaging 0.853 phenotype 05/15/2017
15 254983 UTSW Nalcn 1.000 R2932 G1 225 N 14 123593018 S137P A G missense Het probably benign 0.064 phenotype 12/29/2014
16 254968 UTSW Nipal1 0.238 R2932 G1 225 N 5 72667635 I224V A G missense Het possibly damaging 0.463 12/29/2014
17 477477 UTSW Oas1g 0.091 R2932 G1 197 N 5 120879143 K283Q T G missense Het probably benign 0.001 phenotype 05/15/2017
18 254980 UTSW Pex12 0.186 R2932 G1 225 N 11 83296223 M300L T A missense Het probably benign 0.000 phenotype 12/29/2014
19 254985 UTSW Phldb2 0.195 R2932 G1 225 N 16 45748785 V1237A A G missense Het possibly damaging 0.849 12/29/2014
20 254965 UTSW Rc3h2 0.000 R2932 G1 225 N 2 37378359 V920F C A missense Het probably benign 0.103 phenotype 12/29/2014
21 254969 UTSW Ulk1 0.000 R2932 G1 225 N 5 110789357 R691Q C T missense Het probably benign 0.033 0.090 phenotype 12/29/2014
[records 1 to 21 of 21]