Incidental Mutations

79 incidental mutations are currently displayed, and affect 79 genes.
13 are Possibly Damaging.
25 are Probably Damaging.
33 are Probably Benign.
5 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 273388 UTSW 1810041L15Rik 0.069 R3772 G1 225 Y 15 84406685 Y120* A T nonsense Het probably null 0.631 03/25/2015
2 359670 UTSW Abcb11 0.253 R3772 G1 225 Y 2 69329376 T A splice site Het probably benign 0.100 phenotype 11/13/2015
3 273358 UTSW Adgrl1 0.000 R3772 G1 225 Y 8 83923004 N97S A G missense Het possibly damaging 0.586 0.194 phenotype 03/25/2015
4 273365 UTSW Aldh1a2 1.000 R3772 G1 225 Y 9 71252920 D76G A G missense Het probably damaging 1.000 0.510 phenotype 03/25/2015
5 273373 UTSW Aldh3a1 0.000 R3772 G1 225 Y 11 61214605 E179G A G missense Het possibly damaging 0.859 0.088 phenotype 03/25/2015
6 273359 UTSW Ap1g1 1.000 R3772 G1 225 Y 8 109837786 D324G A G missense Het probably damaging 1.000 0.418 phenotype 03/25/2015
7 273335 UTSW Arfgap2 0.902 R3772 G1 225 Y 2 91265366 T12A A G missense Het probably benign 0.000 0.090 phenotype 03/25/2015
8 273339 UTSW Aurka 1.000 R3772 G1 225 Y 2 172366960 L85P A G missense Het probably benign 0.000 0.134 phenotype 03/25/2015
9 273393 UTSW Birc6 1.000 R3772 G1 225 Y 17 74618429 T A splice site Het probably benign 0.060 phenotype 03/25/2015
10 273340 UTSW Bmp7 1.000 R3772 G1 225 Y 2 172870222 I403N A T missense Het probably damaging 1.000 0.312 phenotype 03/25/2015
11 359672 UTSW Carns1 0.121 R3772 G1 199 Y 19 4170916 A G splice site Het probably benign phenotype 11/13/2015
12 273377 UTSW Ccdc88c 0.000 R3772 G1 218 Y 12 100966100 G A unclassified Het probably benign phenotype 03/25/2015
13 273375 UTSW Ccl2 0.116 R3772 G1 225 Y 11 82036958 A76V C T missense Het probably damaging 0.996 0.198 phenotype 03/25/2015
14 273366 UTSW Cd109 0.000 R3772 G1 199 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.156 phenotype 03/25/2015
15 273370 UTSW Clstn2 0.000 R3772 G1 213 Y 9 97582562 I180T A G missense Het probably damaging 0.996 0.158 phenotype 03/25/2015
16 273343 UTSW Col24a1 0.000 R3772 G1 225 Y 3 145545286 L1680P T C missense Het probably damaging 0.999 0.182 phenotype 03/25/2015
17 273397 UTSW Col4a6 0.000 R3772 G1 222 Y X 141172200 G1416C C A missense Het probably damaging 1.000 0.599 phenotype 03/25/2015
18 273349 UTSW Ctnna2 0.932 R3772 G1 225 Y 6 76973769 N573T T G missense Het probably damaging 0.994 0.106 phenotype 03/25/2015
19 273381 UTSW Cts8 0.113 R3772 G1 225 Y 13 61250901 G A splice site Het probably benign 03/25/2015
20 473709 UTSW Cxcl17 0.000 R3772 G1 225 N 7 25400329 A G utr 3 prime Het probably benign phenotype 04/14/2017
21 273323 UTSW Defb18 0.081 R3772 G1 225 Y 1 18236621 H37R T C missense Het possibly damaging 0.533 0.064 phenotype 03/25/2015
22 273327 UTSW Dis3l2 0.152 R3772 G1 225 Y 1 86854408 I229T T C missense Het probably benign 0.000 0.112 phenotype 03/25/2015
23 273350 UTSW Dysf 0.000 R3772 G1 225 Y 6 84152351 S1474N G A missense Het possibly damaging 0.633 0.074 phenotype 03/25/2015
24 273384 UTSW Elf1 0.394 R3772 G1 225 Y 14 79567210 V105A T C missense Het possibly damaging 0.734 0.386 phenotype 03/25/2015
25 273379 UTSW F13a1 0.000 R3772 G1 225 Y 13 36898134 K532R T C missense Het probably benign 0.000 0.178 phenotype 03/25/2015
26 273336 UTSW Fmn1 0.246 R3772 G1 225 Y 2 113582118 S996A T G missense Het probably damaging 0.996 0.166 phenotype 03/25/2015
27 273344 UTSW Focad 0.431 R3772 G1 225 Y 4 88336161 A C splice site Het probably benign 03/25/2015
28 273329 UTSW Frmd4a 0.225 R3772 G1 225 Y 2 4590622 E109D A T missense Het probably damaging 0.994 0.025 phenotype 03/25/2015
29 273342 UTSW Frrs1 0.279 R3772 G1 225 Y 3 116878387 S45A T G missense Het possibly damaging 0.706 0.164 phenotype 03/25/2015
30 273371 UTSW Gm5422 0.918 R3772 G1 225 Y 10 31248514 T A exon Het noncoding transcript 0.124 03/25/2015
31 273346 UTSW Gm5866 0.280 R3772 G1 172 Y 5 52582746 T C exon Het noncoding transcript 0.414 03/25/2015
32 273331 UTSW Hmcn2 0.000 R3772 G1 225 Y 2 31360896 T790M C T missense Het probably damaging 0.985 0.114 03/25/2015
33 273354 UTSW Iglon5 0.073 R3772 G1 225 Y 7 43480613 Y42* A T nonsense Het probably null 0.658 03/25/2015
34 473705 UTSW Khdrbs2 0.249 R3772 G1 182 N 1 32244076 Q90* C T nonsense Het probably null phenotype 04/14/2017
35 273389 UTSW Krt74 0.000 R3772 G1 225 Y 15 101762195 T C exon Het noncoding transcript 0.514 03/25/2015
36 273328 UTSW Lamc2 0.776 R3772 G1 225 Y 1 153124251 M1121L T A missense Het probably benign 0.000 0.116 phenotype 03/25/2015
37 273351 UTSW Lrig1 0.000 R3772 G1 225 Y 6 94605817 L1073P A G missense Het probably benign 0.005 0.046 phenotype 03/25/2015
38 273395 UTSW Lrp5 0.928 R3772 G1 225 Y 19 3612330 R173C G A missense Het probably damaging 1.000 0.560 phenotype 03/25/2015
39 273363 UTSW Man2c1 0.000 R3772 G1 225 Y 9 57140377 C A unclassified Het probably benign phenotype 03/25/2015
40 273394 UTSW Megf10 0.588 R3772 G1 225 Y 18 57283862 D768N G A missense Het probably benign 0.391 0.214 phenotype 03/25/2015
41 273385 UTSW Mycbp2 1.000 R3772 G1 225 Y 14 103133788 N4108S T C missense Het possibly damaging 0.823 0.288 phenotype 03/25/2015
42 273378 UTSW Nid1 0.184 R3772 G1 225 Y 13 13476418 A G splice site Het probably benign 0.068 phenotype 03/25/2015
43 273382 UTSW Nnt 0.222 R3772 G1 225 Y 13 119396952 V59A A G missense Het probably damaging 0.994 0.238 phenotype 03/25/2015
44 273380 UTSW Nsd1 1.000 R3772 G1 225 Y 13 55246673 V696I G A missense Het probably benign 0.005 0.131 phenotype 03/25/2015
45 273391 UTSW Olfr99 0.061 R3772 G1 225 Y 17 37279854 T189A T C missense Het probably benign 0.001 0.218 phenotype 03/25/2015
46 273341 UTSW Pag1 0.000 R3772 G1 225 Y 3 9699628 T155M G A missense Het probably benign 0.200 0.116 phenotype 03/25/2015
47 273347 UTSW Pgam5 0.000 R3772 G1 225 Y 5 110265593 H176R T C missense Het probably damaging 0.999 0.282 phenotype 03/25/2015
48 273326 UTSW Pid1 0.171 R3772 G1 225 Y 1 84038197 D149G T C missense Het probably damaging 0.999 0.278 03/25/2015
49 273357 UTSW Pkp3 0.161 R3772 G1 225 Y 7 141082346 M1I G A start codon destroyed Het probably null 0.000 0.640 phenotype 03/25/2015
50 273374 UTSW Pld2 0.360 R3772 G1 225 Y 11 70544123 C T unclassified Het probably benign phenotype 03/25/2015
51 273352 UTSW Ptpro 0.000 R3772 G1 225 Y 6 137443594 V1007D T A missense Het probably damaging 1.000 0.624 phenotype 03/25/2015
52 273392 UTSW Ptprs 1.000 R3772 G1 225 Y 17 56428978 T152A T C missense Het possibly damaging 0.585 0.060 phenotype 03/25/2015
53 273396 UTSW Rab9b 0.156 R3772 G1 222 Y X 136861449 E67D T A missense Het probably damaging 0.970 0.250 phenotype 03/25/2015
54 273337 UTSW Rin2 0.173 R3772 G1 225 Y 2 145860446 T354I C T missense Het probably benign 0.005 0.072 phenotype 03/25/2015
55 273362 UTSW Rnf214 0.904 R3772 G1 225 Y 9 45866634 M625V T C missense Het possibly damaging 0.832 0.170 03/25/2015
56 273368 UTSW Rwdd2a 0.222 R3772 G1 225 Y 9 86574161 N130T A C missense Het possibly damaging 0.949 0.244 03/25/2015
57 273333 UTSW Scn9a 1.000 R3772 G1 225 Y 2 66483648 N1909D T C missense Het probably benign 0.259 0.054 phenotype 03/25/2015
58 273372 UTSW Sept10 0.117 R3772 G1 225 Y 10 59176887 M303K A T missense Het probably damaging 0.968 0.124 phenotype 03/25/2015
59 273356 UTSW Sez6l2 0.000 R3772 G1 151 Y 7 126959203 E339G A G missense Het probably damaging 0.993 0.060 phenotype 03/25/2015
60 273324 UTSW Sf3b1 1.000 R3772 G1 225 Y 1 54999991 C A intron Het probably benign 0.645 phenotype 03/25/2015
61 273383 UTSW Ska3 0.863 R3772 G1 225 Y 14 57810077 V334I C T missense Het probably benign 0.057 0.060 phenotype 03/25/2015
62 273387 UTSW Srebf2 1.000 R3772 G1 182 Y 15 82182108 K579R A G missense Het probably benign 0.017 0.096 phenotype 03/25/2015
63 273322 UTSW St18 0.000 R3772 G1 225 Y 1 6844329 K799I A T missense Het probably damaging 0.997 0.352 03/25/2015
64 273376 UTSW Strada 0.411 R3772 G1 225 Y 11 106164822 R333Q C T missense Het probably damaging 0.990 0.286 phenotype 03/25/2015
65 273325 UTSW Stradb 0.000 R3772 G1 225 Y 1 58985385 I64L A T missense Het probably benign 0.043 0.044 phenotype 03/25/2015
66 273348 UTSW Sun1 0.000 R3772 G1 205 Y 5 139238820 A G unclassified Het probably benign 0.066 phenotype 03/25/2015
67 273361 UTSW Tecta 0.122 R3772 G1 225 Y 9 42330996 T2094A T C missense Het probably damaging 0.998 0.120 phenotype 03/25/2015
68 273355 UTSW Tenm4 1.000 R3772 G1 165 Y 7 96694880 R227W A T missense Het probably damaging 1.000 0.026 phenotype 03/25/2015
69 273390 UTSW Tnk2 0.373 R3772 G1 225 Y 16 32679822 D651G A G missense Het probably damaging 1.000 0.144 phenotype 03/25/2015
70 273369 UTSW Trim43c 0.089 R3772 G1 225 Y 9 88847757 D417V A T missense Het probably damaging 0.999 0.028 03/25/2015
71 473707 UTSW Tsc22d4 0.000 R3772 G1 105 N 5 137759233 L374P T C missense Het possibly damaging 0.864 phenotype 04/14/2017
72 273334 UTSW Ttn 1.000 R3772 G1 225 Y 2 76771367 T16872A T C missense Het probably benign 0.399 0.222 phenotype 03/25/2015
73 273345 UTSW Ubr4 1.000 R3772 G1 101 Y 4 139452700 V262A T C missense Het possibly damaging 0.892 0.212 phenotype 03/25/2015
74 273353 UTSW Vmn2r60 0.110 R3772 G1 225 Y 7 42116556 N29I A T missense Het probably benign 0.351 0.164 03/25/2015
75 273338 UTSW Xrn2 0.962 R3772 G1 225 Y 2 147061287 V765A T C missense Het probably benign 0.115 0.055 phenotype 03/25/2015
76 359671 UTSW Zbed4 0.549 R3772 G1 63 Y 15 88780787 P353S C T missense Het probably benign 0.000 0.126 11/13/2015
77 273386 UTSW Zfp251 0.090 R3772 G1 225 Y 15 76853636 I414T A G missense Het possibly damaging 0.672 0.202 03/25/2015
78 273360 UTSW Zfp426 0.082 R3772 G1 225 Y 9 20473117 A T splice site Het probably null 0.614 phenotype 03/25/2015
79 273364 UTSW Zwilch 1.000 R3772 G1 225 Y 9 64156034 F286I A T missense Het probably benign 0.025 0.104 03/25/2015
[records 1 to 79 of 79]