Incidental Mutations

70 incidental mutations are currently displayed, and affect 70 genes.
8 are Possibly Damaging.
25 are Probably Damaging.
25 are Probably Benign.
12 are Probably Null.
5 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 273470 UTSW 1700061G19Rik 0.164 R3773 G1 225 N 17 56876262 M1T T C start codon destroyed Het probably null 0.003 03/25/2015
2 273460 UTSW 1810041L15Rik 0.058 R3773 G1 225 N 15 84406685 Y120* A T nonsense Het probably null 0.631 03/25/2015
3 273429 UTSW A2ml1 0.219 R3773 G1 225 N 6 128555083 K899N T A missense Het probably benign 0.019 03/25/2015
4 273453 UTSW Adgrv1 0.000 R3773 G1 225 N 13 81499043 S3126L G A missense Het probably damaging 0.980 phenotype 03/25/2015
5 273446 UTSW Apba3 0.521 R3773 G1 225 N 10 81272609 C A unclassified Het probably null phenotype 03/25/2015
6 273399 UTSW Apobec4 0.140 R3773 G1 225 N 1 152756805 A195S G T missense Het probably benign 0.000 phenotype 03/25/2015
7 273416 UTSW Asap3 0.152 R3773 G1 225 N 4 136227575 T72I C T missense Het probably benign 0.223 phenotype 03/25/2015
8 473725 UTSW BC067074 0.412 R3773 G1 225 N 13 113318209 E263G A G missense Het probably benign 0.123 04/14/2017
9 273426 UTSW Cand2 0.309 R3773 G1 214 N 6 115785217 H201Q T A missense Het probably damaging 0.958 03/25/2015
10 273441 UTSW Cd109 0.000 R3773 G1 148 N 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.156 phenotype 03/25/2015
11 273465 UTSW Chd1 0.000 R3773 G1 225 N 17 17374651 D16G A G missense Het probably damaging 0.998 0.546 phenotype 03/25/2015
12 273427 UTSW Csgalnact2 0.198 R3773 G1 225 N 6 118126219 K19E T C missense Het probably benign 0.173 phenotype 03/25/2015
13 273478 UTSW Cyp17a1 0.238 R3773 G1 225 N 19 46669723 K250T T G missense Het probably damaging 0.972 phenotype 03/25/2015
14 273451 UTSW Ddx41 0.932 R3773 G1 225 N 13 55534480 R205W G A missense Het possibly damaging 0.868 0.040 phenotype 03/25/2015
15 273463 UTSW Dgcr8 1.000 R3773 G1 225 N 16 18256775 D712G T C missense Het probably damaging 0.987 phenotype 03/25/2015
16 273473 UTSW Dsg2 0.151 R3773 G1 225 N 18 20591862 W442R T C missense Het probably damaging 1.000 phenotype 03/25/2015
17 273414 UTSW Elavl2 0.613 R3773 G1 225 N 4 91264088 G131R C T missense Het probably damaging 1.000 phenotype 03/25/2015
18 273455 UTSW Elf1 0.356 R3773 G1 225 N 14 79567210 V105A T C missense Het possibly damaging 0.734 0.386 phenotype 03/25/2015
19 273452 UTSW Ercc6l2 0.511 R3773 G1 225 N 13 63841450 D270G A G missense Het probably damaging 1.000 phenotype 03/25/2015
20 273408 UTSW Fmn1 0.401 R3773 G1 225 N 2 113582118 S996A T G missense Het probably damaging 0.996 0.166 phenotype 03/25/2015
21 273401 UTSW Frmd4a 0.356 R3773 G1 225 N 2 4590622 E109D A T missense Het probably damaging 0.994 0.025 phenotype 03/25/2015
22 273423 UTSW Fry 0.576 R3773 G1 225 N 5 150398198 R999S A T missense Het probably damaging 0.960 03/25/2015
23 273421 UTSW Gak 1.000 R3773 G1 225 N 5 108582672 T956I G A missense Het probably benign 0.001 phenotype 03/25/2015
24 273431 UTSW Gm6614 0.091 R3773 G1 225 N 6 141972335 K605R T C missense Het probably benign 0.165 03/25/2015
25 273425 UTSW Gm9008 0.166 R3773 G1 155 N 6 76496959 V225I C T missense Het probably benign 0.002 03/25/2015
26 273448 UTSW Gps2 0.737 R3773 G1 225 N 11 69916101 F21L T C missense Het probably damaging 0.986 phenotype 03/25/2015
27 273415 UTSW Grhl3 0.887 R3773 G1 225 N 4 135555847 W303* C T nonsense Het probably null phenotype 03/25/2015
28 273403 UTSW Hmcn2 0.771 R3773 G1 225 N 2 31360896 T790M C T missense Het probably damaging 0.985 0.114 03/25/2015
29 273475 UTSW Lrp5 0.788 R3773 G1 225 N 19 3612330 R173C G A missense Het probably damaging 1.000 0.560 phenotype 03/25/2015
30 273445 UTSW Matk 0.000 R3773 G1 224 N 10 81258297 L21Q T A missense Het probably benign 0.048 phenotype 03/25/2015
31 273417 UTSW Mthfr 0.696 R3773 G1 225 N 4 148044450 V160A T C missense Het probably benign 0.002 phenotype 03/25/2015
32 273467 UTSW Nhlrc4 0.042 R3773 G1 164 N 17 25943393 K127* T A nonsense Het probably null 0.608 03/25/2015
33 273450 UTSW Nsd1 1.000 R3773 G1 225 N 13 55246673 V696I G A missense Het probably benign 0.005 0.131 phenotype 03/25/2015
34 273412 UTSW Nup210l 0.244 R3773 G1 225 N 3 90119894 Y194* T G nonsense Het probably null 0.684 phenotype 03/25/2015
35 273476 UTSW Olfr1497 0.202 R3773 G1 225 N 19 13795204 M136L T A missense Het probably benign 0.002 phenotype 03/25/2015
36 273404 UTSW Olfr345 0.094 R3773 G1 225 N 2 36640321 Y94F A T missense Het probably benign 0.162 phenotype 03/25/2015
37 273444 UTSW Olfr57 0.088 R3773 G1 225 N 10 79035180 C128Y G A missense Het possibly damaging 0.946 phenotype 03/25/2015
38 273468 UTSW Olfr90 0.047 R3773 G1 225 N 17 37086065 Y33* G T nonsense Het probably null phenotype 03/25/2015
39 273474 UTSW Pcdhb15 0.068 R3773 G1 225 N 18 37475890 V725D T A missense Het probably benign 0.001 phenotype 03/25/2015
40 273447 UTSW Pes1 1.000 R3773 G1 225 N 11 3975548 Y221C A G missense Het probably damaging 1.000 phenotype 03/25/2015
41 273472 UTSW Prkd3 0.192 R3773 G1 225 N 17 78959106 I603V T C missense Het possibly damaging 0.525 phenotype 03/25/2015
42 273420 UTSW Ptpn13 0.284 R3773 G1 225 N 5 103477121 E97G A G missense Het probably damaging 1.000 phenotype 03/25/2015
43 273430 UTSW Ptpro 0.000 R3773 G1 225 N 6 137443594 V1007D T A missense Het probably damaging 1.000 0.624 phenotype 03/25/2015
44 273469 UTSW Ptprs 0.528 R3773 G1 225 N 17 56428978 T152A T C missense Het possibly damaging 0.585 0.060 phenotype 03/25/2015
45 273398 UTSW Rims1 0.448 R3773 G1 225 N 1 22421810 D842G T C missense Het probably damaging 0.998 phenotype 03/25/2015
46 273409 UTSW Rin2 0.276 R3773 G1 220 N 2 145860446 T354I C T missense Het probably benign 0.005 0.072 phenotype 03/25/2015
47 273413 UTSW Rngtt 0.971 R3773 G1 225 N 4 33330889 I164T T C missense Het probably damaging 1.000 03/25/2015
48 273406 UTSW Scn9a 1.000 R3773 G1 225 N 2 66483648 N1909D T C missense Het probably benign 0.259 0.054 phenotype 03/25/2015
49 273454 UTSW Ska3 0.863 R3773 G1 225 N 14 57810077 V334I C T missense Het probably benign 0.057 0.060 phenotype 03/25/2015
50 273459 UTSW Srebf2 1.000 R3773 G1 225 N 15 82182108 K579R A G missense Het probably benign 0.017 0.096 phenotype 03/25/2015
51 273442 UTSW Stxbp5 1.000 R3773 G1 225 N 10 9768927 T960I G A missense Het probably damaging 1.000 phenotype 03/25/2015
52 273400 UTSW Suco 0.830 R3773 G1 225 N 1 161843996 A T splice site 6 bp Het probably null phenotype 03/25/2015
53 273439 UTSW Tecta 0.166 R3773 G1 140 N 9 42330996 T2094A T C missense Het probably damaging 0.998 0.120 phenotype 03/25/2015
54 273435 UTSW Tenm4 1.000 R3773 G1 225 N 7 96694880 R227W A T missense Het probably damaging 1.000 0.026 phenotype 03/25/2015
55 273411 UTSW Tmem131l 0.169 R3773 G1 225 N 3 83898586 S1517P A G missense Het probably damaging 0.999 03/25/2015
56 273457 UTSW Trio 1.000 R3773 G1 225 N 15 27748091 S2492P A G missense Het probably damaging 0.975 0.206 phenotype 03/25/2015
57 273434 UTSW Tsg101 1.000 R3773 G1 225 N 7 46889615 *254W T C makesense Het probably null phenotype 03/25/2015
58 273407 UTSW Ttn 1.000 R3773 G1 225 N 2 76771367 T16872A T C missense Het probably benign 0.399 0.222 phenotype 03/25/2015
59 273419 UTSW Ugt2b38 0.063 R3773 G1 105 N 5 87424095 V26A A G missense Het probably damaging 0.989 03/25/2015
60 273443 UTSW Upb1 0.146 R3773 G1 225 N 10 75439838 T A intron Het probably null phenotype 03/25/2015
61 273424 UTSW Vmn1r32 0.086 R3773 G1 225 N 6 66553367 I142F T A missense Het probably benign 0.014 03/25/2015
62 273432 UTSW Vmn1r60 0.071 R3773 G1 225 N 7 5544711 C130F C A missense Het possibly damaging 0.757 03/25/2015
63 273466 UTSW Vmn2r101 0.212 R3773 G1 225 N 17 19589657 D235G A G missense Het probably benign 0.000 0.114 03/25/2015
64 273428 UTSW Wnk1 1.000 R3773 G1 225 N 6 120002280 R282Q C T missense Het possibly damaging 0.876 0.114 phenotype 03/25/2015
65 273410 UTSW Xrn2 0.973 R3773 G1 225 N 2 147061287 V765A T C missense Het probably benign 0.115 0.055 phenotype 03/25/2015
66 273461 UTSW Zbed4 0.469 R3773 G1 125 N 15 88780847 S373P T C missense Het probably benign 0.054 03/25/2015
67 273458 UTSW Zfp251 0.215 R3773 G1 225 N 15 76853636 I414T A G missense Het possibly damaging 0.672 0.202 03/25/2015
68 273437 UTSW Zfp423 0.898 R3773 G1 225 N 8 87780512 L1047Q A T missense Het probably benign 0.030 phenotype 03/25/2015
69 273438 UTSW Zfp426 0.224 R3773 G1 225 N 9 20473117 A T splice site Het probably null 0.614 phenotype 03/25/2015
70 273433 UTSW Zfp61 0.043 R3773 G1 225 N 7 24295981 M1V T C start codon destroyed Het probably null 0.008 0.655 03/25/2015
[records 1 to 70 of 70]