Incidental Mutations

44 incidental mutations are currently displayed, and affect 44 genes.
7 are Possibly Damaging.
19 are Probably Damaging.
17 are Probably Benign.
1 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 44 of 44] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 272528 UTSW A630073D07Rik 0.156 R3791 G1 111 N 6 132626516 AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG small deletion Het probably benign 03/25/2015
2 272545 UTSW A930009A15Rik 0.063 R3791 G1 225 N 10 115578289 A T intron Het probably benign 03/25/2015
3 272551 UTSW Adgrv1 0.000 R3791 G1 225 N 13 81593102 Y81C T C missense Het probably damaging 0.998 phenotype 03/25/2015
4 272519 UTSW Alx3 0.000 R3791 G1 82 N 3 107600706 Y177F A T missense Het probably damaging 0.999 phenotype 03/25/2015
5 272553 UTSW C6 0.332 R3791 G1 225 N 15 4735235 T138A A G missense Het probably benign 0.001 phenotype 03/25/2015
6 272552 UTSW Cacna2d3 0.000 R3791 G1 225 N 14 29183581 M410V T C missense Het probably benign 0.033 phenotype 03/25/2015
7 272542 UTSW Celsr3 1.000 R3791 G1 225 N 9 108842552 R2450H G A missense Het probably benign 0.000 0.034 phenotype 03/25/2015
8 272547 UTSW Cnrip1 0.072 R3791 G1 225 N 11 17054845 C T intron Het probably benign phenotype 03/25/2015
9 272541 UTSW Col6a5 0.920 R3791 G1 225 N 9 105864669 D2350E A C missense Het probably damaging 0.991 phenotype 03/25/2015
10 272521 UTSW Cyp4a12b 0.045 R3791 G1 225 N 4 115434970 I407V A G missense Het probably benign 0.012 03/25/2015
11 272544 UTSW Gpx4 1.000 R3791 G1 225 N 10 80056189 I245V A G missense Het probably benign 0.014 phenotype 03/25/2015
12 272561 UTSW H2-K1 0.114 R3791 G1 225 N 17 33999525 I139T A G missense Het probably benign 0.017 phenotype 03/25/2015
13 272524 UTSW Hmgcl 1.000 R3791 G1 225 N 4 135959987 K191R A G missense Het probably benign 0.005 phenotype 03/25/2015
14 272522 UTSW Hpdl 0.325 R3791 G1 225 N 4 116820532 V244A A G missense Het possibly damaging 0.950 03/25/2015
15 272527 UTSW Hpse 0.000 R3791 G1 176 N 5 100692238 S338P A G missense Het probably damaging 1.000 phenotype 03/25/2015
16 272515 UTSW Ifi203 0.082 R3791 G1 225 N 1 173935080 K162R T C missense Het possibly damaging 0.828 03/25/2015
17 272526 UTSW Kit 0.852 R3791 G1 225 N 5 75639150 N514S A G missense Het probably damaging 0.995 phenotype 03/25/2015
18 272558 UTSW Kmt2d 1.000 R3791 G1 225 N 15 98844149 G A unclassified Het probably benign phenotype 03/25/2015
19 272543 UTSW Limd1 0.359 R3791 G1 225 N 9 123480374 S379R T A missense Het possibly damaging 0.915 phenotype 03/25/2015
20 272546 UTSW Llph 0.218 R3791 G1 225 N 10 120228155 K59E A G missense Het probably benign 0.243 03/25/2015
21 272520 UTSW Lrrc7 0.752 R3791 G1 225 N 3 158163956 M709L T A missense Het probably benign 0.000 phenotype 03/25/2015
22 272532 UTSW Muc5ac 0.000 R3791 G1 225 N 7 141798501 S665G A G missense Het probably benign 0.317 phenotype 03/25/2015
23 272539 UTSW Ncapd3 0.957 R3791 G1 225 N 9 27052635 H524Y C T missense Het probably benign 0.266 phenotype 03/25/2015
24 272534 UTSW Nfix 0.340 R3791 G1 101 N 8 84716247 CAAAAA CAAAA frame shift Het probably null 0.623 phenotype 03/25/2015
25 272531 UTSW Olfr571 0.151 R3791 G1 225 N 7 102909032 D269G T C missense Het probably benign 0.143 phenotype 03/25/2015
26 272535 UTSW Papd5 0.852 R3791 G1 225 N 8 88243329 E210K G A missense Het probably damaging 0.998 03/25/2015
27 272525 UTSW Phtf2 0.248 R3791 G1 225 N 5 20782298 E400G T C missense Het probably damaging 0.996 03/25/2015
28 272536 UTSW Pkd1l3 0.000 R3791 G1 225 N 8 109636317 V1080A T C missense Het probably damaging 0.988 phenotype 03/25/2015
29 473604 UTSW Plch1 0.193 R3791 G1 225 N 3 63699523 H1007Q A T missense Het probably benign 0.000 phenotype 04/14/2017
30 272557 UTSW Prr5 0.079 R3791 G1 168 N 15 84681216 S3P T C missense Het probably damaging 1.000 phenotype 03/25/2015
31 272538 UTSW Qtrt1 0.430 R3791 G1 220 N 9 21419340 D279N G A missense Het probably damaging 0.999 phenotype 03/25/2015
32 272549 UTSW Rundc1 0.188 R3791 G1 198 N 11 101434201 A578T G A missense Het probably damaging 0.965 03/25/2015
33 272517 UTSW Shc4 0.226 R3791 G1 137 N 2 125723331 V16E A T missense Het probably damaging 0.971 03/25/2015
34 272540 UTSW Sik3 1.000 R3791 G1 225 N 9 46194822 L329F A T missense Het possibly damaging 0.945 phenotype 03/25/2015
35 272548 UTSW Slc36a3 0.103 R3791 G1 225 N 11 55125156 S391P A G missense Het possibly damaging 0.949 03/25/2015
36 272533 UTSW Smad1 1.000 R3791 G1 225 N 8 79339770 R426L C A missense Het probably damaging 1.000 phenotype 03/25/2015
37 272523 UTSW Thrap3 0.260 R3791 G1 225 N 4 126167500 N820K A T missense Het possibly damaging 0.759 03/25/2015
38 272556 UTSW Tnrc6b 0.354 R3791 G1 225 N 15 80923640 S1598P T C missense Het probably damaging 0.998 phenotype 03/25/2015
39 272516 UTSW Ttn 1.000 R3791 G1 225 N 2 76714824 I32645V T C missense Het probably damaging 0.995 phenotype 03/25/2015
40 272555 UTSW Wisp1 0.113 R3791 G1 225 N 15 66919288 Y313C A G missense Het probably damaging 1.000 phenotype 03/25/2015
41 272537 UTSW Zfp266 0.059 R3791 G1 225 N 9 20499481 Y467D A C missense Het probably damaging 0.994 phenotype 03/25/2015
42 272529 UTSW Zfp526 0.321 R3791 G1 225 N 7 25226203 M629K T A missense Het probably damaging 0.979 03/25/2015
43 272530 UTSW Zfp788 0.054 R3791 G1 225 N 7 41649728 H596L A T missense Het probably damaging 0.988 03/25/2015
44 272518 UTSW Zhx3 1.000 R3791 G1 225 N 2 160780448 W600R A G missense Het possibly damaging 0.939 phenotype 03/25/2015
[records 1 to 44 of 44]