Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
12 are Possibly Damaging.
17 are Probably Damaging.
14 are Probably Benign.
3 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 315839 UTSW 1700019A02Rik 0.142 R4061 G1 225 Y 1 53158769 L140Q A T missense Het probably damaging 0.974 0.066 05/15/2015
2 315863 UTSW Adam25 0.098 R4061 G1 225 Y 8 40753782 I28M A G missense Het possibly damaging 0.665 0.072 phenotype 05/15/2015
3 315869 UTSW Anks1b 0.242 R4061 G1 225 Y 10 90307622 S464G A G missense Het probably damaging 0.981 0.058 phenotype 05/15/2015
4 315850 UTSW AU040320 0.588 R4061 G1 225 Y 4 126835695 M550K T A missense Het probably damaging 0.999 0.238 phenotype 05/15/2015
5 315877 UTSW Cab39l 0.184 R4061 G1 225 Y 14 59499607 K59E A G missense Het possibly damaging 0.642 0.030 05/15/2015
6 315881 UTSW Cdc5l 0.982 R4061 G1 225 Y 17 45410890 A485T C T missense Het probably benign 0.001 0.146 phenotype 05/15/2015
7 315862 UTSW Csmd1 0.291 R4061 G1 225 Y 8 15945158 S2626P A G missense Het probably benign 0.001 0.252 phenotype 05/15/2015
8 315848 UTSW Ctss 0.135 R4061 G1 225 N 3 95543034 R99W C T missense Het probably benign 0.343 phenotype 05/15/2015
9 315878 UTSW Deptor 0.143 R4061 G1 225 Y 15 55208781 M219L A T missense Het probably benign 0.000 0.058 05/15/2015
10 315843 UTSW Disp1 0.828 R4061 G1 219 Y 1 183087700 V1052A A G missense Het probably damaging 0.962 0.118 phenotype 05/15/2015
11 315866 UTSW Esyt3 0.236 R4061 G1 225 Y 9 99320838 S504N C T missense Het probably damaging 1.000 0.178 phenotype 05/15/2015
12 315864 UTSW Fat1 1.000 R4061 G1 225 Y 8 45025481 E2521D A T missense Het probably benign 0.089 0.076 phenotype 05/15/2015
13 315859 UTSW Folh1 0.000 R4061 G1 225 Y 7 86756962 Y301F T A missense Het possibly damaging 0.486 0.060 phenotype 05/15/2015
14 368216 UTSW Gm14443 0.123 R4061 G1 29 Y 2 175169609 T348I G A missense Het probably benign 0.013 0.058 01/06/2016
15 315882 UTSW Gtpbp2 0.497 R4061 G1 225 Y 17 46167327 R467H G A missense Het probably damaging 0.999 0.310 phenotype 05/15/2015
16 315883 UTSW Hnrnpll 0.527 R4061 G1 225 Y 17 80032772 H526R T C missense Het probably benign 0.007 0.070 phenotype 05/15/2015
17 315844 UTSW Iars2 0.927 R4061 G1 225 Y 1 185303386 H552Q A T missense Het possibly damaging 0.852 0.186 phenotype 05/15/2015
18 315838 UTSW Il18r1 0.043 R4061 G1 225 Y 1 40474936 V101I G A missense Het probably benign 0.329 0.122 phenotype 05/15/2015
19 315867 UTSW Impdh2 1.000 R4061 G1 225 Y 9 108562804 R182G A G missense Het possibly damaging 0.460 0.098 phenotype 05/15/2015
20 315873 UTSW Krt12 0.109 R4061 G1 225 Y 11 99416015 M487K A T missense Het unknown 0.082 phenotype 05/15/2015
21 315879 UTSW Lmln 0.125 R4061 G1 225 Y 16 33066391 Y89* C A nonsense Het probably null 0.630 phenotype 05/15/2015
22 315851 UTSW Lrrc38 0.092 R4061 G1 225 Y 4 143350506 L113Q T A missense Het probably damaging 1.000 0.024 05/15/2015
23 315865 UTSW Mast3 0.250 R4061 G1 225 Y 8 70781194 V969A A G missense Het probably damaging 1.000 0.284 05/15/2015
24 315861 UTSW Muc5ac 0.000 R4061 G1 225 Y 7 141811130 D1947G A G missense Het possibly damaging 0.845 0.212 phenotype 05/15/2015
25 315872 UTSW Myh13 0.361 R4061 G1 225 Y 11 67330889 I177F A T missense Het possibly damaging 0.714 0.228 05/15/2015
26 315840 UTSW Nfasc 1.000 R4061 G1 225 Y 1 132597845 Y904C T C missense Het probably damaging 1.000 0.270 phenotype 05/15/2015
27 315871 UTSW Obscn 0.693 R4061 G1 225 Y 11 59008532 P1000S G A missense Het probably damaging 0.998 0.032 phenotype 05/15/2015
28 315845 UTSW Olfr1086 0.120 R4061 G1 225 Y 2 86676818 I172F T A missense Het probably damaging 0.997 0.284 phenotype 05/15/2015
29 315860 UTSW Olfr658 0.015 R4061 G1 225 Y 7 104644473 K298* T A nonsense Het probably null 0.540 phenotype 05/15/2015
30 315874 UTSW Otop2 0.079 R4061 G1 225 Y 11 115329375 G347D G A missense Het probably damaging 1.000 0.444 05/15/2015
31 315852 UTSW Pclo 0.000 R4061 G1 225 Y 5 14540566 E960G A G missense Het unknown 0.132 phenotype 05/15/2015
32 315868 UTSW Plagl1 0.337 R4061 G1 123 Y 10 13128771 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC unclassified Het probably benign phenotype 05/15/2015
33 315875 UTSW Prl7a1 0.068 R4061 G1 225 Y 13 27635849 I141V T C missense Het possibly damaging 0.831 0.026 05/15/2015
34 315837 UTSW Ptpn18 0.217 R4061 G1 219 Y 1 34472930 H45L A T missense Het possibly damaging 0.663 0.078 phenotype 05/15/2015
35 315856 UTSW Sbno1 0.939 R4061 G1 225 Y 5 124388572 M960K A T missense Het probably damaging 0.996 0.254 05/15/2015
36 315846 UTSW Slx4ip 0.164 R4061 G1 225 Y 2 137005017 S67R T A missense Het probably benign 0.080 0.164 05/15/2015
37 315854 UTSW Spata18 0.225 R4061 G1 225 Y 5 73671166 K243E A G missense Het probably damaging 1.000 0.272 ApcMin allele leads to increased intestinal adenoma and adenocarcinoma tumor incidence and size. This double mutation and homozygous KO of the gene alone results in lower internal mitochondrial cristae density in small intestinal mucosal epithelium. [provided by MGI curators] (source: MGI)">phenotype 05/15/2015
38 315880 UTSW Tcp1 0.959 R4061 G1 225 Y 17 12920863 Q265R A G missense Het probably benign 0.000 0.096 phenotype 05/15/2015
39 315853 UTSW Tec 0.188 R4061 G1 198 Y 5 72823409 C T unclassified Het probably benign 0.066 phenotype 05/15/2015
40 315876 UTSW Thbs4 0.000 R4061 G1 225 Y 13 92776097 A G critical splice donor site 2 bp Het probably null 0.494 phenotype 05/15/2015
41 315849 UTSW Tln1 1.000 R4061 G1 225 Y 4 43549177 Q635L T A missense Het probably damaging 0.999 0.320 phenotype 05/15/2015
42 315847 UTSW Tshz2 1.000 R4061 G1 225 Y 2 169962325 A G intron Het probably benign phenotype 05/15/2015
43 315841 UTSW Uap1 0.407 R4061 G1 225 Y 1 170158846 E189G T C missense Het possibly damaging 0.711 0.184 05/15/2015
44 315842 UTSW Usp21 0.000 R4061 G1 225 Y 1 171285401 G A unclassified Het probably benign phenotype 05/15/2015
45 315858 UTSW Vmn1r118 R4061 G1 147 N 7 20912008 Q114K G T missense Het probably damaging 0.964 05/15/2015
46 315857 UTSW Vmn1r38 0.190 R4061 G1 225 Y 6 66776848 C95S A T missense Het possibly damaging 0.865 0.060 05/15/2015
47 315855 UTSW Vmn2r12 0.162 R4061 G1 225 Y 5 109092192 N168K A T missense Het possibly damaging 0.948 0.069 05/15/2015
48 315870 UTSW Vmn2r84 0.046 R4061 G1 194 N 10 130386029 E774V T A missense Het probably damaging 0.998 05/15/2015
[records 1 to 48 of 48]