Incidental Mutations

49 incidental mutations are currently displayed, and affect 49 genes.
4 are Possibly Damaging.
25 are Probably Damaging.
19 are Probably Benign.
1 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 49 of 49] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 325829 UTSW Adrb2 0.000 R4367 G1 225 Y 18 62179056 I233V T C missense Het probably damaging 0.998 0.250 phenotype 07/06/2015
2 325800 UTSW Alox5 0.214 R4367 G1 197 Y 6 116460963 Y21F T A missense Het possibly damaging 0.856 0.184 phenotype 07/06/2015
3 325792 UTSW Ank2 1.000 R4367 G1 225 Y 3 126946149 T1942A T C missense Het probably benign 0.000 0.055 phenotype 07/06/2015
4 325785 UTSW B4galt3 0.376 R4367 G1 225 Y 1 171274043 H196N C A missense Het probably damaging 1.000 0.318 phenotype 07/06/2015
5 325808 UTSW Bckdk 0.182 R4367 G1 225 Y 7 127906419 A238V C T missense Het probably benign 0.071 0.102 phenotype 07/06/2015
6 325812 UTSW Casp1 0.000 R4367 G1 225 Y 9 5299333 T21A A G missense Het probably benign 0.411 0.112 phenotype 07/06/2015
7 325788 UTSW Ccdc39 0.639 R4367 G1 225 Y 3 33826522 H432R T C missense Het probably benign 0.009 0.028 phenotype 07/06/2015
8 325797 UTSW Cttnbp2 0.279 R4367 G1 225 Y 6 18405249 C574G A C missense Het probably damaging 1.000 0.052 phenotype 07/06/2015
9 325814 UTSW Cyp1a1 0.138 R4367 G1 225 Y 9 57700149 V20A T C missense Het probably benign 0.000 0.151 phenotype 07/06/2015
10 325811 UTSW Dhx38 0.982 R4367 G1 225 Y 8 109553131 V976I C T missense Het probably damaging 0.998 0.474 phenotype 07/06/2015
11 325799 UTSW Dnah6 0.241 R4367 G1 225 Y 6 73149484 S1287P A G missense Het possibly damaging 0.948 0.282 phenotype 07/06/2015
12 325791 UTSW Dnttip2 0.950 R4367 G1 225 Y 3 122276497 S454P T C missense Het probably damaging 1.000 0.288 phenotype 07/06/2015
13 325798 UTSW Doxl2 0.029 R4367 G1 225 Y 6 48976130 S330P T C missense Het probably damaging 0.998 0.226 07/06/2015
14 325832 UTSW Drp2 0.081 R4367 G1 222 Y X 134435135 A T intron Het probably benign 0.061 phenotype 07/06/2015
15 325820 UTSW Flcn 1.000 R4367 G1 225 Y 11 59803784 V121I C T missense Het possibly damaging 0.903 0.055 phenotype 07/06/2015
16 325784 UTSW Fmo1 0.128 R4367 G1 225 Y 1 162833648 Y355* G C nonsense Het probably null 0.610 phenotype 07/06/2015
17 325795 UTSW Git2 0.420 R4367 G1 225 Y 5 114764666 H138L T A missense Het probably damaging 1.000 0.384 phenotype 07/06/2015
18 325803 UTSW Gpr162 0.331 R4367 G1 225 N 6 124861695 G A start gained Het probably benign phenotype 07/06/2015
19 325789 UTSW Kcnd3 0.000 R4367 G1 225 Y 3 105658766 A421V C T missense Het probably damaging 1.000 0.354 phenotype 07/06/2015
20 325786 UTSW Kcnt1 0.502 R4367 G1 225 Y 2 25907626 I881T T C missense Het probably damaging 1.000 0.414 phenotype 07/06/2015
21 325828 UTSW Lama3 1.000 R4367 G1 225 Y 18 12513690 C1754S T A missense Het probably damaging 0.999 0.594 phenotype 07/06/2015
22 325824 UTSW Mpp3 0.244 R4367 G1 225 Y 11 102023420 D116E A T missense Het probably benign 0.006 0.056 phenotype 07/06/2015
23 325827 UTSW Myh11 1.000 R4367 G1 225 Y 16 14218883 D985G T C missense Het probably damaging 0.974 0.180 phenotype 07/06/2015
24 325801 UTSW Necap1 0.192 R4367 G1 225 Y 6 122887378 V273A T C missense Het probably damaging 0.992 0.348 phenotype 07/06/2015
25 325810 UTSW Nlrc5 0.000 R4367 G1 225 Y 8 94476564 S431P T C missense Het probably damaging 0.997 0.086 phenotype 07/06/2015
26 325825 UTSW Nutm2 0.063 R4367 G1 225 Y 13 50469884 T206S A T missense Het probably benign 0.006 0.121 07/06/2015
27 325813 UTSW Olfr27 0.034 R4367 G1 225 Y 9 39144429 A110T G A missense Het probably damaging 0.978 0.332 phenotype 07/06/2015
28 325807 UTSW Olfr507 0.096 R4367 G1 225 Y 7 108621889 L26F C T missense Het probably benign 0.266 0.004 phenotype 07/06/2015
29 325806 UTSW Olfr707 0.114 R4367 G1 217 Y 7 106891360 GAACAACAACAA GAACAACAA small deletion Het probably benign 0.062 phenotype 07/06/2015
30 325817 UTSW Phactr2 0.112 R4367 G1 225 Y 10 13253820 S235P A G missense Het probably damaging 1.000 0.164 07/06/2015
31 325809 UTSW Podnl1 0.161 R4367 G1 225 Y 8 84127268 R89H G A missense Het probably benign 0.029 0.116 07/06/2015
32 325790 UTSW Prpf38b 0.935 R4367 G1 225 Y 3 108911171 Y91C T C missense Het probably damaging 1.000 0.470 07/06/2015
33 325796 UTSW Radil 0.601 R4367 G1 225 Y 5 142494805 A632T C T missense Het probably benign 0.060 0.164 07/06/2015
34 325794 UTSW Rpap2 0.915 R4367 G1 225 Y 5 107601795 V62I G A missense Het possibly damaging 0.952 0.216 07/06/2015
35 325822 UTSW Sdf2 0.620 R4367 G1 225 Y 11 78251037 T66I C T missense Het probably damaging 1.000 0.526 phenotype 07/06/2015
36 325821 UTSW Specc1 0.360 R4367 G1 225 Y 11 62118530 S371P T C missense Het probably damaging 1.000 0.286 phenotype 07/06/2015
37 325783 UTSW Suco 0.820 R4367 G1 225 Y 1 161847230 E416G T C missense Het probably damaging 1.000 0.230 phenotype 07/06/2015
38 325787 UTSW Sys1 0.448 R4367 G1 225 Y 2 164461395 W10R T C missense Het probably damaging 1.000 0.448 phenotype 07/06/2015
39 325804 UTSW Tarsl2 0.259 R4367 G1 225 Y 7 65682819 T556M C T missense Het probably damaging 0.967 0.037 07/06/2015
40 325830 UTSW Tcirg1 0.496 R4367 G1 225 Y 19 3899069 D407N C T missense Het probably damaging 1.000 0.284 phenotype 07/06/2015
41 325823 UTSW Tefm 0.954 R4367 G1 225 Y 11 80140330 L27I G T missense Het probably benign 0.061 0.120 07/06/2015
42 325819 UTSW Tenm2 0.000 R4367 G1 225 Y 11 36027398 I1845T A G missense Het probably benign 0.000 0.100 phenotype 07/06/2015
43 325818 UTSW Tfam 1.000 R4367 G1 225 Y 10 71233403 I119N A T missense Het probably damaging 1.000 0.031 phenotype 07/06/2015
44 325793 UTSW Tle1 0.765 R4367 G1 217 Y 4 72118163 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT utr 3 prime Het probably benign 0.061 07/06/2015
45 325831 UTSW Trpm6 1.000 R4367 G1 225 Y 19 18827525 I947T T C missense Het probably damaging 0.992 0.070 phenotype 07/06/2015
46 325805 UTSW Ubqlnl 0.095 R4367 G1 225 Y 7 104149718 V191M C T missense Het probably benign 0.003 0.110 phenotype 07/06/2015
47 325826 UTSW Usp54 0.480 R4367 G1 225 Y 14 20561134 T1205A T C missense Het probably benign 0.020 0.032 07/06/2015
48 325802 UTSW Vmn2r25 0.132 R4367 G1 225 Y 6 123828537 R454G T C missense Het probably damaging 0.996 0.070 07/06/2015
49 325816 UTSW Xylb 0.189 R4367 G1 225 Y 9 119388715 V477A T C missense Het probably benign 0.103 0.044 phenotype 07/06/2015
[records 1 to 49 of 49]