Incidental Mutations

53 incidental mutations are currently displayed, and affect 51 genes.
6 are Possibly Damaging.
24 are Probably Damaging.
17 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 53 of 53] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 325233 UTSW Abcb1b 0.303 R4379 G1 225 Y 5 8865875 H1252Q C A missense Het probably benign 0.001 0.126 phenotype 07/06/2015
2 325255 UTSW Adcy3 0.816 R4379 G1 225 Y 12 4134558 L78P T C missense Het probably damaging 1.000 0.340 phenotype 07/06/2015
3 325232 UTSW Agmat 0.140 R4379 G1 225 Y 4 141757491 A282S G T missense Het probably benign 0.099 0.187 07/06/2015
4 325266 UTSW Akap8 0.000 R4379 G1 225 Y 17 32306560 T515K G T missense Het probably damaging 0.994 0.055 phenotype 07/06/2015
5 325267 UTSW Akap8l 0.550 R4379 G1 225 Y 17 32321514 T C unclassified Het probably benign 0.146 07/06/2015
6 325230 UTSW Alpk1 0.000 R4379 G1 225 Y 3 127729373 V7M C T missense Het probably damaging 0.977 0.064 phenotype 07/06/2015
7 325257 UTSW AW209491 0.222 R4379 G1 225 Y 13 14637827 *422Q T C makesense Het probably null 0.480 07/06/2015
8 325226 UTSW Cdan1 1.000 R4379 G1 225 Y 2 120726618 F576L A G missense Het probably damaging 0.999 0.268 phenotype 07/06/2015
9 325263 UTSW Cers5 0.000 R4379 G1 225 Y 15 99751253 F45L A G missense Het probably damaging 0.999 0.460 phenotype 07/06/2015
10 325220 UTSW Dst 0.330 R4379 G1 225 Y 1 34163235 S215P T C missense Het probably damaging 0.999 0.162 phenotype 07/06/2015
11 325221 UTSW Dst 0.330 R4379 G1 225 Y 1 34227975 I5011V A G missense Het probably benign 0.068 0.114 phenotype 07/06/2015
12 325223 UTSW En1 1.000 R4379 G1 216 N 1 120603355 N108S A G missense Het possibly damaging 0.528 phenotype 07/06/2015
13 325229 UTSW Fam189b 0.109 R4379 G1 217 N 3 89185757 D274V A T missense Het probably damaging 1.000 phenotype 07/06/2015
14 325242 UTSW Fancd2 1.000 R4379 G1 225 Y 6 113561716 S591P T C missense Het probably benign 0.004 0.135 phenotype 07/06/2015
15 325235 UTSW Glt1d1 0.056 R4379 G1 225 Y 5 127694282 V279A T C missense Het possibly damaging 0.729 0.136 07/06/2015
16 325236 UTSW Gm10051 0.233 R4379 G1 211 Y 5 133475448 C T exon Het noncoding transcript 07/06/2015
17 325224 UTSW Gpr158 0.000 R4379 G1 225 Y 2 21825214 G690V G T missense Het probably damaging 1.000 0.158 07/06/2015
18 325241 UTSW Grm7 0.000 R4379 G1 225 Y 6 110646348 V161F G T missense Het probably damaging 1.000 0.084 phenotype 07/06/2015
19 377760 UTSW Grm7 0.000 R4379 G1 225 Y 6 111246374 N458K T A missense Het probably benign 0.053 0.030 phenotype 04/01/2016
20 325238 UTSW Hibadh 0.000 R4379 G1 225 Y 6 52620042 S139L G A missense Het probably damaging 0.976 0.206 phenotype 07/06/2015
21 325258 UTSW Hivep1 0.561 R4379 G1 225 Y 13 42155430 S382F C T missense Het probably damaging 0.997 0.192 phenotype 07/06/2015
22 377759 UTSW Ift74 0.000 R4379 G1 225 Y 4 94679934 N403D A G missense Het probably benign 0.001 0.076 phenotype 04/01/2016
23 325240 UTSW Igkv4-81 0.106 R4379 G1 225 Y 6 68990949 L56S A G missense Het probably damaging 0.971 0.036 07/06/2015
24 325254 UTSW Igsf9b 0.869 R4379 G1 225 Y 9 27309478 V47I G A missense Het possibly damaging 0.953 0.064 07/06/2015
25 325247 UTSW Klk14 0.000 R4379 G1 225 Y 7 43692077 C51Y G A missense Het probably damaging 1.000 0.628 phenotype 07/06/2015
26 325262 UTSW Lmbr1l 0.000 R4379 G1 225 Y 15 98909263 C212* G T nonsense Het probably null 0.626 phenotype 07/06/2015
27 325260 UTSW Lrp10 0.000 R4379 G1 212 N 14 54468366 R338C C T missense Het probably damaging 0.976 phenotype 07/06/2015
28 325228 UTSW Lrrc34 0.064 R4379 G1 225 Y 3 30631375 L275P A G missense Het probably damaging 1.000 0.420 07/06/2015
29 325237 UTSW Mgam2-ps 0.097 R4379 G1 225 Y 6 40833859 T C exon Het noncoding transcript 07/06/2015
30 325261 UTSW Mief1 0.000 R4379 G1 225 Y 15 80247959 M77R T G missense Het possibly damaging 0.858 0.192 07/06/2015
31 325239 UTSW Neurod6 0.000 R4379 G1 225 Y 6 55679272 T127A T C missense Het probably damaging 0.985 0.096 phenotype 07/06/2015
32 325222 UTSW Nif3l1 0.353 R4379 G1 225 Y 1 58455579 A C intron Het probably benign 0.064 phenotype 07/06/2015
33 325243 UTSW Nlrp12 0.121 R4379 G1 225 Y 7 3239924 T653S T A missense Het probably benign 0.083 0.124 phenotype 07/06/2015
34 377762 UTSW Nol7 0.924 R4379 G1 225 Y 13 43401575 W228L G T missense Het probably damaging 0.999 0.572 phenotype 04/01/2016
35 325251 UTSW Nrp1 1.000 R4379 G1 225 Y 8 128468467 R468H G A missense Het probably damaging 1.000 0.176 phenotype 07/06/2015
36 325264 UTSW Olfr194 0.062 R4379 G1 225 Y 16 59119664 M135I C T missense Het probably benign 0.220 0.125 phenotype 07/06/2015
37 325253 UTSW Olfr854 0.212 R4379 G1 225 Y 9 19566742 L211P A G missense Het probably benign 0.150 0.314 phenotype 07/06/2015
38 325259 UTSW Pbrm1 1.000 R4379 G1 225 Y 14 31067706 H785L A T missense Het probably damaging 0.999 0.304 phenotype 07/06/2015
39 325234 UTSW Pus7 0.352 R4379 G1 225 Y 5 23748866 T C intron Het probably benign 0.062 07/06/2015
40 325225 UTSW Qser1 0.469 R4379 G1 225 Y 2 104766059 G T splice site Het probably null 0.618 07/06/2015
41 325250 UTSW Rrm1 0.968 R4379 G1 225 Y 7 102446593 V51A T C missense Het probably damaging 0.997 0.166 phenotype 07/06/2015
42 325271 UTSW Setbp1 0.526 R4379 G1 225 Y 18 79086681 N112S T C missense Het probably damaging 1.000 0.208 phenotype 07/06/2015
43 325270 UTSW Svil 0.283 R4379 G1 225 Y 18 5046909 H52Y C T missense Het probably damaging 0.999 0.148 phenotype 07/06/2015
44 325252 UTSW Taf1d 0.836 R4379 G1 225 Y 9 15311981 T A intron Het probably benign 0.072 phenotype 07/06/2015
45 325231 UTSW Tle1 0.741 R4379 G1 217 Y 4 72118163 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT utr 3 prime Het probably benign 0.061 07/06/2015
46 325269 UTSW Treml1 0.000 R4379 G1 225 Y 17 48360396 Y103C A G missense Het probably damaging 1.000 0.406 phenotype 07/06/2015
47 325246 UTSW Trim28 1.000 R4379 G1 225 Y 7 13029480 D516V A T missense Het probably damaging 0.992 0.268 phenotype 07/06/2015
48 377761 UTSW Usp34 0.560 R4379 G1 225 Y 11 23384499 N1164K T A missense Het possibly damaging 0.525 0.084 04/01/2016
49 325265 UTSW Vmn2r115 0.161 R4379 G1 225 Y 17 23345223 Y123C A G missense Het possibly damaging 0.952 0.064 07/06/2015
50 325248 UTSW Vrk3 0.000 R4379 G1 218 Y 7 44775442 T427M C T missense Het probably benign 0.001 0.125 phenotype 07/06/2015
51 325244 UTSW Zfp28 0.108 R4379 G1 225 Y 7 6393442 T292I C T missense Het probably benign 0.112 0.130 07/06/2015
52 325227 UTSW Zmynd8 1.000 R4379 G1 225 Y 2 165807938 A T splice site Het probably null 0.648 phenotype 07/06/2015
53 325245 UTSW Zscan4d 0.147 R4379 G1 225 Y 7 11164978 V124A A G missense Het probably benign 0.000 0.153 07/06/2015
[records 1 to 53 of 53]