Incidental Mutations

41 incidental mutations are currently displayed, and affect 41 genes.
7 are Possibly Damaging.
15 are Probably Damaging.
15 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 41 of 41] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 330814 UTSW Cacna1b 0.000 R4493 G1 225 Y 2 24652938 T1301A T C missense Het probably damaging 0.994 0.182 phenotype 07/21/2015
2 330817 UTSW Ccdc141 0.000 R4493 G1 225 Y 2 77132297 V101A A G missense Het probably damaging 0.999 0.194 phenotype 07/21/2015
3 330824 UTSW Ccdc146 0.000 R4493 G1 225 Y 5 21303193 E619G T C missense Het possibly damaging 0.923 0.040 phenotype 07/21/2015
4 330843 UTSW Cmya5 0.238 R4493 G1 225 Y 13 93094065 E1505G T C missense Het probably benign 0.000 0.084 07/21/2015
5 330823 UTSW Cngb3 0.093 R4493 G1 225 Y 4 19367778 P229Q C A missense Het probably damaging 1.000 0.264 phenotype 07/21/2015
6 330829 UTSW Ctnna2 0.932 R4493 G1 225 Y 6 76981848 V461A A G missense Het probably damaging 0.985 0.218 phenotype 07/21/2015
7 330818 UTSW D430041D05Rik 0.176 R4493 G1 225 Y 2 104256339 D764G T C missense Het probably benign 0.017 07/21/2015
8 330828 UTSW Dgki 0.000 R4493 G1 225 Y 6 36974861 T C intron Het probably benign phenotype 07/21/2015
9 330820 UTSW Dhx36 1.000 R4493 G1 225 Y 3 62488504 A T intron Het probably benign 0.066 phenotype 07/21/2015
10 330826 UTSW Gcn1l1 0.953 R4493 G1 225 Y 5 115594144 I1006T T C missense Het probably benign 0.000 0.164 07/21/2015
11 330838 UTSW Glt8d2 0.136 R4493 G1 225 Y 10 82664713 M20L T A missense Het possibly damaging 0.541 0.032 phenotype 07/21/2015
12 330840 UTSW Greb1 0.000 R4493 G1 225 Y 12 16698610 G1122V C A missense Het probably benign 0.139 0.059 phenotype 07/21/2015
13 330813 UTSW Hmcn1 0.000 R4493 G1 225 Y 1 150701899 I2037N A T missense Het probably damaging 0.998 0.104 phenotype 07/21/2015
14 330819 UTSW Hspa4l 0.252 R4493 G1 225 Y 3 40768002 I340V A G missense Het possibly damaging 0.771 0.148 phenotype 07/21/2015
15 330848 UTSW Itpr3 0.000 R4493 G1 225 Y 17 27104612 K1204E A G missense Het probably damaging 0.999 0.156 phenotype 07/21/2015
16 330849 UTSW Kcnh8 0.000 R4493 G1 217 Y 17 52725906 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA small deletion Het probably benign 0.131 phenotype 07/21/2015
17 330842 UTSW Lyst 0.423 R4493 G1 225 Y 13 13635383 R546H G A missense Het probably damaging 1.000 0.025 phenotype 07/21/2015
18 330846 UTSW Maats1 0.000 R4493 G1 225 Y 16 38341768 T4A T C missense Het probably benign 0.001 0.046 07/21/2015
19 330833 UTSW Mcph1 0.000 R4493 G1 225 Y 8 18631736 C296* T A nonsense Het probably null 0.630 phenotype 07/21/2015
20 330839 UTSW Mrc2 0.000 R4493 G1 225 Y 11 105348431 G A splice site 5 bp Het probably null 0.623 phenotype 07/21/2015
21 330844 UTSW Naga 0.000 R4493 G1 225 Y 15 82332514 F259S A G missense Het probably damaging 0.999 0.486 phenotype 07/21/2015
22 330821 UTSW Nes 0.479 R4493 G1 225 Y 3 87976813 E793G A G missense Het probably damaging 0.959 0.080 phenotype 07/21/2015
23 330853 UTSW Nfkb2 0.588 R4493 G1 225 Y 19 46308439 D316G A G missense Het probably damaging 0.991 0.134 phenotype 07/21/2015
24 330850 UTSW Pcdha4 0.127 R4493 G1 225 Y 18 36954591 Y609F A T missense Het possibly damaging 0.803 0.138 phenotype 07/21/2015
25 330852 UTSW Pgam1 0.258 R4493 G1 225 N 19 41915776 A104V C T missense Het possibly damaging 0.822 phenotype 07/21/2015
26 330851 UTSW Piezo2 1.000 R4493 G1 225 Y 18 63114063 I525V T C missense Het probably damaging 0.982 0.214 phenotype 07/21/2015
27 330832 UTSW Pold1 0.960 R4493 G1 225 Y 7 44537708 V683A A G missense Het probably damaging 1.000 0.330 phenotype 07/21/2015
28 330834 UTSW Poteg 0.072 R4493 G1 225 Y 8 27480097 V316A T C missense Het possibly damaging 0.682 0.066 07/21/2015
29 377824 UTSW Ppih 0.367 R4493 G1 225 Y 4 119310845 N156K A T missense Het probably damaging 0.994 0.266 phenotype 04/11/2016
30 330837 UTSW Prep 1.000 R4493 G1 225 Y 10 45120819 F398L T C missense Het probably benign 0.380 0.310 phenotype 07/21/2015
31 330854 UTSW Prlhr 0.078 R4493 G1 185 Y 19 60467081 M349K A T missense Het probably benign 0.044 0.124 phenotype 07/21/2015
32 330845 UTSW Rtp4 0.067 R4493 G1 225 Y 16 23610077 H30L A T missense Het probably benign 0.228 0.168 07/21/2015
33 330816 UTSW Stkld1 0.083 R4493 G1 157 Y 2 26946626 N268S A G missense Het probably benign 0.001 0.106 07/21/2015
34 330822 UTSW Syt6 0.146 R4493 G1 225 Y 3 103585630 E66G A G missense Het probably damaging 0.986 0.082 phenotype 07/21/2015
35 330831 UTSW Tas2r129 0.054 R4493 G1 225 Y 6 132951354 I85V A G missense Het probably benign 0.314 0.117 07/21/2015
36 330835 UTSW Tma16 0.924 R4493 G1 225 Y 8 66484171 C T critical splice acceptor site Het probably null 0.484 07/21/2015
37 330815 UTSW Tprn 0.000 R4493 G1 225 Y 2 25268892 S643P T C missense Het probably damaging 1.000 0.190 phenotype 07/21/2015
38 330827 UTSW Trrap 1.000 R4493 G1 225 Y 5 144831048 V2605A T C missense Het probably benign 0.207 0.126 phenotype 07/21/2015
39 330847 UTSW Vmn1r230 0.051 R4493 G1 225 Y 17 20846601 N17K T A missense Het probably benign 0.000 0.125 07/21/2015
40 330855 UTSW Xkrx 0.000 R4493 G1 222 Y X 134150996 N302S T C missense Het possibly damaging 0.931 0.039 phenotype 07/21/2015
41 377825 UTSW Zfp946 0.062 R4493 G1 225 Y 17 22451086 T A splice site Het probably null 0.632 04/11/2016
[records 1 to 41 of 41]