Incidental Mutations

43 incidental mutations are currently displayed, and affect 42 genes.
10 are Possibly Damaging.
16 are Probably Damaging.
12 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 43 of 43] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 344232 UTSW 2010111I01Rik 0.121 R4593 G1 225 Y 13 63068092 S393P T C missense Het probably benign 0.007 0.028 phenotype 09/25/2015
2 344226 UTSW 2700049A03Rik 1.000 R4593 G1 225 Y 12 71164546 E685* G T nonsense Het probably null 0.614 phenotype 09/25/2015
3 344227 UTSW 2700049A03Rik 1.000 R4593 G1 225 Y 12 71164547 E685V A T missense Het possibly damaging 0.931 0.276 phenotype 09/25/2015
4 344218 UTSW Atm 0.821 R4593 G1 225 Y 9 53453594 A8E G T missense Het possibly damaging 0.549 0.154 phenotype 09/25/2015
5 344228 UTSW Atxn3 0.000 R4593 G1 225 Y 12 101923177 M333K A T missense Het probably benign 0.014 0.180 phenotype 09/25/2015
6 344236 UTSW Cd86 0.092 R4593 G1 225 Y 16 36606556 *310R A G makesense Het probably null 0.651 phenotype 09/25/2015
7 344212 UTSW Cyp2s1 0.000 R4593 G1 161 N 7 25816442 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG unclassified Het probably benign phenotype 09/25/2015
8 344234 UTSW Dgat1 0.493 R4593 G1 225 Y 15 76504689 R111S C A missense Het probably damaging 0.998 0.025 phenotype 09/25/2015
9 377735 UTSW Dner 0.000 R4593 G1 69 Y 1 84695728 M1V T C start codon destroyed Het probably null 0.418 phenotype 04/01/2016
10 344215 UTSW Dnhd1 0.119 R4593 G1 225 Y 7 105715446 D4240N G A missense Het probably benign 0.021 0.020 09/25/2015
11 344213 UTSW Emp3 0.254 R4593 G1 145 Y 7 45919353 L27P A G missense Het probably damaging 1.000 0.210 phenotype 09/25/2015
12 344216 UTSW Glra3 0.000 R4593 G1 225 Y 8 55940881 G9V G T missense Het probably damaging 0.996 0.026 phenotype 09/25/2015
13 344201 UTSW Gpr149 0.075 R4593 G1 225 Y 3 62602730 A T intron Het probably benign phenotype 09/25/2015
14 344229 UTSW Ighv1-9 0.274 R4593 G1 225 Y 12 114583604 T105A T C missense Het probably benign 0.117 0.113 09/25/2015
15 344202 UTSW Kcnd3 0.000 R4593 G1 225 Y 3 105658766 A421V C T missense Het probably damaging 1.000 0.354 phenotype 09/25/2015
16 344217 UTSW Ldhd 0.196 R4593 G1 225 Y 8 111629364 D129G T C missense Het probably damaging 1.000 0.274 phenotype 09/25/2015
17 344237 UTSW Lnpep 0.000 R4593 G1 225 Y 17 17579027 V122A A G missense Het probably benign 0.002 0.070 phenotype 09/25/2015
18 344223 UTSW Lrrc37a 0.135 R4593 G1 225 Y 11 103498969 Y1877H A G missense Het possibly damaging 0.643 0.062 09/25/2015
19 344207 UTSW Med13l 0.961 R4593 G1 225 Y 5 118742560 L1239P T C missense Het probably damaging 0.998 0.150 phenotype 09/25/2015
20 344238 UTSW Mib1 1.000 R4593 G1 225 Y 18 10768191 L480S T C missense Het possibly damaging 0.887 0.202 phenotype 09/25/2015
21 344214 UTSW Mkrn3 0.000 R4593 G1 225 Y 7 62418804 W413* C T nonsense Het probably null 0.692 phenotype 09/25/2015
22 344239 UTSW Myo7b 0.000 R4593 G1 225 Y 18 32013375 V119A A G missense Het possibly damaging 0.775 0.078 phenotype 09/25/2015
23 344203 UTSW Nexn 0.371 R4593 G1 225 Y 3 152252916 R113S T A missense Het probably damaging 1.000 0.120 phenotype 09/25/2015
24 344225 UTSW Npas3 0.938 R4593 G1 107 Y 12 54068497 Q703L A T missense Het probably benign 0.084 0.064 phenotype 09/25/2015
25 344204 UTSW Npr2 0.859 R4593 G1 225 Y 4 43647323 A G unclassified Het probably benign phenotype 09/25/2015
26 344206 UTSW Nub1 0.852 R4593 G1 225 Y 5 24709121 Y624C A G missense Het probably damaging 1.000 0.258 phenotype 09/25/2015
27 344221 UTSW Obscn 0.858 R4593 G1 225 Y 11 59133249 S532A A C missense Het probably damaging 0.999 0.066 phenotype 09/25/2015
28 344199 UTSW Olfr1016 0.089 R4593 G1 225 Y 2 85799664 L202P A G missense Het probably damaging 1.000 0.104 phenotype 09/25/2015
29 344222 UTSW Olfr393 0.137 R4593 G1 225 Y 11 73847314 K270N T A missense Het probably benign 0.221 0.129 phenotype 09/25/2015
30 344235 UTSW Panx2 0.000 R4593 G1 225 Y 15 89067915 I195T T C missense Het probably damaging 0.999 0.336 phenotype 09/25/2015
31 344209 UTSW Parp11 0.000 R4593 G1 225 N 6 127474299 I104T T C missense Het probably benign 0.033 phenotype 09/25/2015
32 344220 UTSW Pkd1l1 1.000 R4593 G1 225 Y 11 8901253 D726E G T missense Het probably damaging 0.972 0.216 phenotype 09/25/2015
33 344230 UTSW Pom121l2 0.068 R4593 G1 225 Y 13 21984453 R965W C T missense Het probably damaging 1.000 0.032 09/25/2015
34 344198 UTSW Prrc2c 0.353 R4593 G1 225 Y 1 162697532 K502E T C missense Het probably damaging 0.998 0.242 09/25/2015
35 344233 UTSW Rasa1 1.000 R4593 G1 225 Y 13 85238221 T C splice site Het probably null 0.614 phenotype 09/25/2015
36 344208 UTSW Sva 0.073 R4593 G1 225 N 6 42042658 S151P T C missense Het possibly damaging 0.930 09/25/2015
37 344205 UTSW Svep1 1.000 R4593 G1 225 Y 4 58091944 N1564D T C missense Het possibly damaging 0.707 0.087 phenotype 09/25/2015
38 344224 UTSW Unk 0.705 R4593 G1 225 Y 11 116049056 I129T T C missense Het probably benign 0.017 0.082 09/25/2015
39 377736 UTSW Urb1 1.000 R4593 G1 225 Y 16 90787444 D550G T C missense Het probably damaging 1.000 0.390 04/01/2016
40 344231 UTSW Vmn1r194 0.072 R4593 G1 225 Y 13 22244291 M26K T A missense Het possibly damaging 0.600 0.061 09/25/2015
41 344210 UTSW Vmn1r59 0.061 R4593 G1 225 Y 7 5454687 F25I A T missense Het possibly damaging 0.455 0.058 09/25/2015
42 344211 UTSW Vmn1r88 0.081 R4593 G1 225 Y 7 13177842 K42E A G missense Het probably damaging 0.962 0.026 09/25/2015
43 344219 UTSW Zbtb24 1.000 R4593 G1 225 Y 10 41451957 R280G A G missense Het possibly damaging 0.892 0.074 phenotype 09/25/2015
[records 1 to 43 of 43]